Incidental Mutation 'R7315:Dsg2'
ID 567925
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Name desmoglein 2
Synonyms D18Ertd293e
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20691131-20737578 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20712217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 118 (I118F)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]
AlphaFold O55111
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: I118F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: I118F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120102
AA Change: I118F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: I118F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Pfam:Cadherin 282 347 6.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121837
AA Change: I118F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393
AA Change: I118F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20,734,826 (GRCm39) missense probably benign 0.10
IGL00979:Dsg2 APN 18 20,715,824 (GRCm39) missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20,722,999 (GRCm39) unclassified probably benign
IGL01358:Dsg2 APN 18 20,734,850 (GRCm39) missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20,712,233 (GRCm39) missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20,723,077 (GRCm39) missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20,735,189 (GRCm39) missense probably benign 0.04
IGL02553:Dsg2 APN 18 20,725,467 (GRCm39) missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20,712,134 (GRCm39) missense probably damaging 0.99
dissolute UTSW 18 20,729,008 (GRCm39) splice site probably null
Dysjunction UTSW 18 20,715,996 (GRCm39) nonsense probably null
weg UTSW 18 20,713,708 (GRCm39) nonsense probably null
R0094:Dsg2 UTSW 18 20,724,910 (GRCm39) missense probably benign 0.08
R0094:Dsg2 UTSW 18 20,724,910 (GRCm39) missense probably benign 0.08
R0105:Dsg2 UTSW 18 20,735,111 (GRCm39) missense probably benign 0.03
R0105:Dsg2 UTSW 18 20,735,111 (GRCm39) missense probably benign 0.03
R0112:Dsg2 UTSW 18 20,716,099 (GRCm39) missense probably benign 0.02
R0305:Dsg2 UTSW 18 20,715,752 (GRCm39) splice site probably benign
R0380:Dsg2 UTSW 18 20,715,996 (GRCm39) nonsense probably null
R0401:Dsg2 UTSW 18 20,725,565 (GRCm39) splice site probably benign
R0421:Dsg2 UTSW 18 20,712,448 (GRCm39) missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20,727,291 (GRCm39) missense probably benign 0.00
R0667:Dsg2 UTSW 18 20,706,556 (GRCm39) missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20,706,550 (GRCm39) missense probably benign 0.23
R1433:Dsg2 UTSW 18 20,715,780 (GRCm39) missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20,727,268 (GRCm39) missense probably benign 0.33
R1730:Dsg2 UTSW 18 20,724,937 (GRCm39) missense probably benign 0.01
R1783:Dsg2 UTSW 18 20,724,937 (GRCm39) missense probably benign 0.01
R1946:Dsg2 UTSW 18 20,713,605 (GRCm39) missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20,734,530 (GRCm39) missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20,734,530 (GRCm39) missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20,716,061 (GRCm39) unclassified probably benign
R2109:Dsg2 UTSW 18 20,725,346 (GRCm39) missense probably benign 0.00
R2143:Dsg2 UTSW 18 20,712,218 (GRCm39) missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20,729,111 (GRCm39) missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20,735,355 (GRCm39) missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20,712,185 (GRCm39) missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20,735,174 (GRCm39) missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20,735,004 (GRCm39) missense probably benign 0.41
R3773:Dsg2 UTSW 18 20,724,919 (GRCm39) missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20,713,720 (GRCm39) missense probably benign 0.25
R4213:Dsg2 UTSW 18 20,731,571 (GRCm39) missense probably benign 0.01
R4299:Dsg2 UTSW 18 20,729,008 (GRCm39) splice site probably null
R4515:Dsg2 UTSW 18 20,734,444 (GRCm39) missense probably benign
R4649:Dsg2 UTSW 18 20,735,302 (GRCm39) missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20,712,487 (GRCm39) missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20,723,241 (GRCm39) missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20,734,578 (GRCm39) missense probably benign 0.26
R5078:Dsg2 UTSW 18 20,729,140 (GRCm39) critical splice donor site probably null
R5155:Dsg2 UTSW 18 20,731,715 (GRCm39) missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20,712,190 (GRCm39) missense probably benign 0.45
R5503:Dsg2 UTSW 18 20,713,708 (GRCm39) nonsense probably null
R6133:Dsg2 UTSW 18 20,723,146 (GRCm39) missense probably benign 0.00
R6163:Dsg2 UTSW 18 20,731,726 (GRCm39) critical splice donor site probably null
R6226:Dsg2 UTSW 18 20,712,506 (GRCm39) missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20,727,350 (GRCm39) critical splice donor site probably null
R6241:Dsg2 UTSW 18 20,723,274 (GRCm39) splice site probably null
R6482:Dsg2 UTSW 18 20,734,371 (GRCm39) missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20,716,093 (GRCm39) missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20,734,859 (GRCm39) missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20,725,332 (GRCm39) missense probably benign 0.00
R7108:Dsg2 UTSW 18 20,734,920 (GRCm39) missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20,712,511 (GRCm39) missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20,734,516 (GRCm39) missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20,724,988 (GRCm39) missense possibly damaging 0.96
R7471:Dsg2 UTSW 18 20,713,675 (GRCm39) missense probably benign 0.08
R7558:Dsg2 UTSW 18 20,727,291 (GRCm39) missense probably benign 0.00
R8094:Dsg2 UTSW 18 20,716,061 (GRCm39) unclassified probably benign
R8118:Dsg2 UTSW 18 20,715,858 (GRCm39) missense probably benign 0.11
R8157:Dsg2 UTSW 18 20,713,606 (GRCm39) missense probably damaging 1.00
R8307:Dsg2 UTSW 18 20,708,121 (GRCm39) missense probably benign 0.19
R8308:Dsg2 UTSW 18 20,708,121 (GRCm39) missense probably benign 0.19
R8488:Dsg2 UTSW 18 20,734,431 (GRCm39) missense probably damaging 1.00
R8520:Dsg2 UTSW 18 20,712,508 (GRCm39) missense probably damaging 1.00
R8669:Dsg2 UTSW 18 20,723,132 (GRCm39) missense probably damaging 1.00
R8675:Dsg2 UTSW 18 20,734,975 (GRCm39) missense possibly damaging 0.75
R8750:Dsg2 UTSW 18 20,708,069 (GRCm39) missense possibly damaging 0.90
R8773:Dsg2 UTSW 18 20,716,056 (GRCm39) missense probably damaging 1.00
R8888:Dsg2 UTSW 18 20,723,126 (GRCm39) missense probably damaging 1.00
R8895:Dsg2 UTSW 18 20,723,126 (GRCm39) missense probably damaging 1.00
R8912:Dsg2 UTSW 18 20,715,878 (GRCm39) missense probably damaging 1.00
R8925:Dsg2 UTSW 18 20,725,535 (GRCm39) missense probably damaging 1.00
R8927:Dsg2 UTSW 18 20,725,535 (GRCm39) missense probably damaging 1.00
R9263:Dsg2 UTSW 18 20,727,223 (GRCm39) missense probably benign 0.33
R9328:Dsg2 UTSW 18 20,715,847 (GRCm39) missense possibly damaging 0.81
Z1176:Dsg2 UTSW 18 20,713,678 (GRCm39) missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20,735,306 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTCTTCAAAAGGACACTGTC -3'
(R):5'- CAATGCATAGCCTGTCAGCTG -3'

Sequencing Primer
(F):5'- AGGACACTGTCATTAAATGCTTTC -3'
(R):5'- CCTGTCAGCTGAATTGCAACATG -3'
Posted On 2019-06-26