Incidental Mutation 'R7316:Ptprc'
ID567931
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R7316 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138064771 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1067 (Y1067C)
Ref Sequence ENSEMBL: ENSMUSP00000138800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
Predicted Effect probably damaging
Transcript: ENSMUST00000182283
AA Change: Y1067C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: Y1067C

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182755
AA Change: Y1043C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: Y1043C

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: Y1206C

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Meta Mutation Damage Score 0.4782 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Pcnx T C 12: 81,995,549 S38P probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
bletchley UTSW 1 138117862 missense probably benign
Blush UTSW 1 138117720 intron probably benign
bruise UTSW 1 138064771 missense probably damaging 1.00
chor_muang UTSW 1 138113562 critical splice donor site probably null
crystal UTSW 1 138072255 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
Gentian UTSW 1 138067885 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
mauve UTSW 1 138099685 missense probably benign
Perverse UTSW 1 138101044 missense probably benign 0.02
ultra UTSW 1 138078445 critical splice donor site probably null
violaceous UTSW 1 138083639 missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
R6995:Ptprc UTSW 1 138088744 missense probably damaging 1.00
R7009:Ptprc UTSW 1 138064553 missense probably damaging 0.97
R7041:Ptprc UTSW 1 138126309 missense probably benign 0.04
R7055:Ptprc UTSW 1 138089571 missense probably damaging 1.00
R7098:Ptprc UTSW 1 138099685 missense probably benign
R7164:Ptprc UTSW 1 138117862 missense probably benign
R7188:Ptprc UTSW 1 138071180 missense probably damaging 1.00
R7191:Ptprc UTSW 1 138101044 missense probably benign 0.02
R7204:Ptprc UTSW 1 138117862 missense probably benign
R7644:Ptprc UTSW 1 138067907 missense probably benign 0.01
R7948:Ptprc UTSW 1 138064576 missense probably benign 0.45
R8029:Ptprc UTSW 1 138078459 missense probably damaging 1.00
Z1177:Ptprc UTSW 1 138067907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTCCTCAGCACTATTGGTAGG -3'
(R):5'- TGTTCCTAAGGTACCCTGCC -3'

Sequencing Primer
(F):5'- TCAGCACTATTGGTAGGCTCCG -3'
(R):5'- AGGTACCCTGCCCATGATCCTAG -3'
Posted On2019-06-26