Mutagenetix > Incidental Mutation

Incidental Mutation 'R7316:Fsip2'

567941

Institutional Source

Beutler Lab

Gene Symbol

Fsip2

Ensembl Gene

ENSMUSG00000075249

Gene Name

fibrous sheath-interacting protein 2

Synonyms

OTTMUSG00000013335

MMRRC Submission

Accession Numbers

Genbank: XM_913669; MGI: 2664111

Essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R7316 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82943634-83008937 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 82989691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 5256 (Y5256S)

Ref Sequence

ENSEMBL: ENSMUSP00000120314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000143764]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000132967

SMART Domains

Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

Domain	Start	End	E-Value	Type
low complexity region	22	38	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	381	392	N/A	INTRINSIC
low complexity region	411	430	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
low complexity region	953	962	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000143764
AA Change: Y5256S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: Y5256S

Domain	Start	End	E-Value	Type
coiled coil region	271	297	N/A	INTRINSIC
low complexity region	544	561	N/A	INTRINSIC
low complexity region	586	597	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
low complexity region	925	939	N/A	INTRINSIC
low complexity region	1115	1120	N/A	INTRINSIC
low complexity region	1531	1545	N/A	INTRINSIC
low complexity region	2044	2057	N/A	INTRINSIC
low complexity region	2507	2523	N/A	INTRINSIC
low complexity region	2564	2575	N/A	INTRINSIC
low complexity region	2866	2877	N/A	INTRINSIC
low complexity region	2896	2915	N/A	INTRINSIC
low complexity region	3220	3231	N/A	INTRINSIC
low complexity region	3438	3447	N/A	INTRINSIC
Pfam:FSIP2	4045	4408	3.5e-42	PFAM
Pfam:FSIP2	4375	4613	7.7e-26	PFAM
Pfam:FSIP2	4622	4932	4.3e-17	PFAM
Pfam:FSIP2	4903	5454	7e-27	PFAM
low complexity region	5507	5522	N/A	INTRINSIC
low complexity region	5769	5780	N/A	INTRINSIC
low complexity region	5834	5846	N/A	INTRINSIC
low complexity region	5851	5867	N/A	INTRINSIC
Pfam:FSIP2	5998	6867	N/A	PFAM
low complexity region	6977	6990	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,304,644	D246G	probably damaging	Het
2810474O19Rik	T	C	6: 149,326,638	L394P	probably damaging	Het
4933434E20Rik	G	A	3: 90,061,713	M214I	probably benign	Het
Aadat	G	T	8: 60,526,634	G177C	probably damaging	Het
Adam4	T	C	12: 81,419,724	I708V	probably benign	Het
Aip	T	C	19: 4,114,793	N264S	probably benign	Het
Alox8	A	T	11: 69,186,238	D505E	probably benign	Het
Ap3d1	A	T	10: 80,717,859	I518N	probably damaging	Het
Arf3	G	A	15: 98,740,993	Q128*	probably null	Het
Asph	A	G	4: 9,537,746	V344A	probably benign	Het
Birc6	A	T	17: 74,604,494	R1500S	probably damaging	Het
Bptf	G	A	11: 107,073,109	T1753I	probably damaging	Het
Bptf	A	T	11: 107,110,914	C457*	probably null	Het
Brpf3	T	A	17: 28,814,686	I568N	probably damaging	Het
Btnl4	G	C	17: 34,469,057	N582K	probably benign	Het
Camsap3	C	A	8: 3,604,648	P773T	possibly damaging	Het
Capsl	A	T	15: 9,461,802	I95L	probably benign	Het
Cd96	T	A	16: 46,069,653	M336L	probably benign	Het
Cdan1	A	T	2: 120,728,332		probably null	Het
Chd3	A	T	11: 69,345,568	L1939Q	probably damaging	Het
Cngb3	A	T	4: 19,425,599	Y469F	probably benign	Het
Cp	T	C	3: 19,972,752	L448P	probably damaging	Het
Csnk1g2	T	C	10: 80,639,853	V418A	possibly damaging	Het
Dag1	A	T	9: 108,209,502	S147T	probably benign	Het
Dnajc25	T	A	4: 59,017,693	Y117*	probably null	Het
Dpysl2	A	T	14: 66,862,595	M64K	possibly damaging	Het
Dus3l	A	G	17: 56,765,551	H38R	possibly damaging	Het
E330021D16Rik	T	C	6: 136,401,278	K185E	possibly damaging	Het
Eme2	G	A	17: 24,894,866	R62W	probably damaging	Het
Enox1	A	T	14: 77,720,858	M616L	probably benign	Het
Epb41l4b	T	A	4: 57,019,867	T708S	probably benign	Het
Fam71f2	A	G	6: 29,286,102	M187V	probably benign	Het
Fat2	A	T	11: 55,286,067	I1534N	probably damaging	Het
Fer1l5	A	G	1: 36,418,116	T1649A	probably benign	Het
Fmo9	A	G	1: 166,663,646	V421A	probably benign	Het
Gapvd1	G	A	2: 34,704,669	L804F	probably damaging	Het
Gen1	A	G	12: 11,241,469	V838A	probably benign	Het
Gnptab	A	T	10: 88,400,710	N59I	probably damaging	Het
Grm5	A	G	7: 87,975,265	T347A	probably benign	Het
Gsdmc3	T	C	15: 63,858,402	N438D	possibly damaging	Het
Hmcn1	A	G	1: 150,732,946	L1495S	probably damaging	Het
Islr2	T	C	9: 58,197,967	E714G	probably damaging	Het
Larp4	A	T	15: 100,001,017	M430L	probably benign	Het
Lpcat2b	A	G	5: 107,433,113	I103V	not run	Het
Lrguk	C	T	6: 34,103,256	S1142F	unknown	Het
Lrit2	G	T	14: 37,068,858	V165F	probably damaging	Het
Mast3	T	A	8: 70,779,788	I1182F	probably damaging	Het
Mcm6	C	T	1: 128,359,508	D20N	probably damaging	Het
Mief1	A	G	15: 80,249,397	I218M	probably damaging	Het
Mmp2	A	G	8: 92,840,410	T453A	probably benign	Het
Ms4a18	T	A	19: 11,001,996	S219C	probably damaging	Het
Myo5c	A	T	9: 75,269,638	T622S	probably benign	Het
Neb	A	T	2: 52,271,438	M2114K	possibly damaging	Het
Nemp1	T	A	10: 127,689,343	L122*	probably null	Het
Nkx2-1	T	C	12: 56,534,798	N88S	probably benign	Het
Nr2c2	T	A	6: 92,154,463	C202S	probably damaging	Het
Ntsr1	A	C	2: 180,500,752	D112A	probably damaging	Het
Olfr114	A	G	17: 37,590,135	S73P	probably damaging	Het
Olfr430	A	T	1: 174,070,161	I288F	probably benign	Het
Olfr680-ps1	A	T	7: 105,090,900	H246Q	probably damaging	Het
Osbp2	C	A	11: 3,726,431	R73L	probably damaging	Het
Pbp2	T	A	6: 135,309,832	E172D	probably damaging	Het
Pcdhgc3	T	C	18: 37,808,448	I634T	probably benign	Het
Pcnx	T	C	12: 81,995,549	S38P	probably benign	Het
Phyh	A	T	2: 4,936,044	K252*	probably null	Het
Plcb3	C	T	19: 6,966,385		probably null	Het
Ppargc1b	T	C	18: 61,307,838	S670G	probably damaging	Het
Ptprc	T	C	1: 138,064,771	Y1067C	probably damaging	Het
Pwwp2b	A	C	7: 139,256,224	E527A	probably benign	Het
Pzp	T	C	6: 128,513,773	D409G	probably damaging	Het
Rbfox2	A	T	15: 77,132,729	N148K	possibly damaging	Het
Rps24	T	C	14: 24,490,689		probably benign	Het
Slc35e4	T	C	11: 3,912,584	K202E	probably damaging	Het
Spata7	C	T	12: 98,658,612	R258W	probably damaging	Het
Spen	A	T	4: 141,477,054	S1421T	unknown	Het
Svep1	T	A	4: 58,068,763	I3008F	possibly damaging	Het
Tbc1d1	G	T	5: 64,335,277		probably null	Het
Thsd4	T	A	9: 59,987,359	H772L	probably benign	Het
Tle1	T	C	4: 72,118,292	I769V	probably benign	Het
Tm4sf19	T	A	16: 32,407,648	S127T	possibly damaging	Het
Tmprss9	C	A	10: 80,894,979	R780S	probably benign	Het
Tpp2	T	C	1: 43,970,431	V475A	probably benign	Het
Ttc30a1	A	T	2: 75,980,857	L294Q	probably damaging	Het
Ttn	A	T	2: 76,766,913	N19885K	probably damaging	Het
Ttn	A	G	2: 76,862,165	V471A		Het
Tub	A	T	7: 109,030,171	T478S	possibly damaging	Het
Vmn2r88	A	T	14: 51,414,255	Y342F		Het
Wdr18	C	A	10: 79,965,225	D157E	probably benign	Het
Xrra1	A	T	7: 99,876,216		probably null	Het
Zc3h4	G	C	7: 16,435,335	G1198A	unknown	Het
Zfp568	A	T	7: 30,022,256	I209F	possibly damaging	Het
Zfp787	C	A	7: 6,155,524		probably benign	Het
Zfp974	A	T	7: 27,910,438	Y621N	possibly damaging	Het
Zyg11b	A	G	4: 108,250,502	I493T	possibly damaging	Het

Other mutations in Fsip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Fsip2	APN	2	82990386	missense	probably benign	0.18
IGL00557:Fsip2	APN	2	82991313	missense	possibly damaging	0.53
IGL01343:Fsip2	APN	2	82999819	missense	possibly damaging	0.53
IGL01387:Fsip2	APN	2	82992982	missense	possibly damaging	0.71
IGL01523:Fsip2	APN	2	82977519	missense	probably benign
IGL01554:Fsip2	APN	2	82977278	missense	possibly damaging	0.68
IGL01650:Fsip2	APN	2	82991086	missense	probably benign	0.33
IGL01809:Fsip2	APN	2	82978347	missense	possibly damaging	0.80
IGL01826:Fsip2	APN	2	82982639	missense	probably benign	0.18
IGL01830:Fsip2	APN	2	82984929	missense	probably benign
IGL01918:Fsip2	APN	2	82992138	missense	possibly damaging	0.71
IGL01932:Fsip2	APN	2	82994005	missense	possibly damaging	0.71
IGL01989:Fsip2	APN	2	82993867	missense	probably damaging	0.99
IGL02096:Fsip2	APN	2	82991860	missense	possibly damaging	0.85
IGL02153:Fsip2	APN	2	82978721	missense	probably benign
IGL02155:Fsip2	APN	2	82998352	missense	probably benign
IGL02219:Fsip2	APN	2	82977830	missense	probably benign	0.07
IGL02248:Fsip2	APN	2	82982772	missense	possibly damaging	0.73
IGL02316:Fsip2	APN	2	82978793	missense	probably benign
IGL02478:Fsip2	APN	2	82984392	missense	probably benign	0.00
IGL02504:Fsip2	APN	2	82978855	missense	possibly damaging	0.83
IGL02572:Fsip2	APN	2	82992003	missense	probably benign	0.32
IGL02625:Fsip2	APN	2	82949492	missense	probably benign	0.00
IGL02665:Fsip2	APN	2	82993063	missense	probably damaging	1.00
IGL02668:Fsip2	APN	2	82998318	missense	probably benign	0.06
IGL02676:Fsip2	APN	2	82982157	missense	possibly damaging	0.53
IGL02717:Fsip2	APN	2	82951026	splice site	probably benign
IGL02805:Fsip2	APN	2	82993495	missense	probably benign	0.01
IGL02943:Fsip2	APN	2	82992357	missense	probably benign	0.32
IGL02965:Fsip2	APN	2	82983054	missense	probably benign	0.33
IGL03001:Fsip2	APN	2	82990624	intron	probably benign
IGL03076:Fsip2	APN	2	82982138	missense	possibly damaging	0.96
IGL03229:Fsip2	APN	2	82978076	missense	possibly damaging	0.86
IGL03353:Fsip2	APN	2	82977393	missense	possibly damaging	0.85
IGL03401:Fsip2	APN	2	82990470	missense	probably benign
bubblegum	UTSW	2	82992840	missense	probably benign	0.16
Dao	UTSW	2	82993150	missense	probably damaging	0.97
engulf	UTSW	2	82984776	missense	probably damaging	0.98
envelope	UTSW	2	82980741	missense	probably benign	0.07
gladius	UTSW	2	82981949	missense	possibly damaging	0.68
glove	UTSW	2	82978394	missense	possibly damaging	0.85
Katana	UTSW	2	82989516	missense	probably benign	0.07
scarf	UTSW	2	82986891	missense	probably benign
Sock	UTSW	2	82998180	missense	probably benign	0.00
swaddle	UTSW	2	82983428	missense	possibly damaging	0.93
wrap	UTSW	2	82986820	missense	probably benign	0.04
Wrapper	UTSW	2	82990086	missense	possibly damaging	0.71
D4186:Fsip2	UTSW	2	82988412	missense	probably benign	0.32
FR4976:Fsip2	UTSW	2	82984362	critical splice acceptor site	probably benign
FR4976:Fsip2	UTSW	2	82984365	critical splice acceptor site	probably benign
PIT4382001:Fsip2	UTSW	2	82990852	missense	possibly damaging	0.86
R0017:Fsip2	UTSW	2	82992072	missense	probably damaging	0.98
R0017:Fsip2	UTSW	2	82992072	missense	probably damaging	0.98
R0021:Fsip2	UTSW	2	82999857	splice site	probably benign
R0054:Fsip2	UTSW	2	82976608	missense	probably damaging	0.96
R0054:Fsip2	UTSW	2	82986955	missense	possibly damaging	0.85
R0054:Fsip2	UTSW	2	82986955	missense	possibly damaging	0.85
R0104:Fsip2	UTSW	2	82978973	missense	possibly damaging	0.91
R0104:Fsip2	UTSW	2	82978973	missense	possibly damaging	0.91
R0127:Fsip2	UTSW	2	82984925	missense	probably benign	0.28
R0131:Fsip2	UTSW	2	82991121	missense	probably benign
R0149:Fsip2	UTSW	2	82975505	missense	possibly damaging	0.93
R0167:Fsip2	UTSW	2	82980807	missense	possibly damaging	0.53
R0190:Fsip2	UTSW	2	82985177	missense	possibly damaging	0.73
R0323:Fsip2	UTSW	2	82985896	missense	probably benign	0.33
R0358:Fsip2	UTSW	2	82983333	missense	possibly damaging	0.56
R0361:Fsip2	UTSW	2	82975505	missense	possibly damaging	0.93
R0369:Fsip2	UTSW	2	82984564	missense	probably benign	0.33
R0394:Fsip2	UTSW	2	82991075	missense	possibly damaging	0.70
R0532:Fsip2	UTSW	2	82977785	missense	probably benign	0.33
R0595:Fsip2	UTSW	2	82946952	missense	probably damaging	0.99
R0613:Fsip2	UTSW	2	82993795	missense	probably damaging	0.99
R0614:Fsip2	UTSW	2	82977533	missense	probably benign	0.15
R0619:Fsip2	UTSW	2	82944140	missense	probably damaging	1.00
R0626:Fsip2	UTSW	2	82988958	missense	probably benign	0.06
R0644:Fsip2	UTSW	2	82976897	missense	probably benign	0.02
R0661:Fsip2	UTSW	2	82986169	missense	possibly damaging	0.92
R0680:Fsip2	UTSW	2	82991359	missense	possibly damaging	0.73
R0688:Fsip2	UTSW	2	82982339	missense	probably benign	0.18
R0881:Fsip2	UTSW	2	82986273	missense	possibly damaging	0.52
R0919:Fsip2	UTSW	2	82985484	missense	possibly damaging	0.53
R0973:Fsip2	UTSW	2	82977092	missense	probably benign	0.05
R0973:Fsip2	UTSW	2	82977092	missense	probably benign	0.05
R0974:Fsip2	UTSW	2	82977092	missense	probably benign	0.05
R0976:Fsip2	UTSW	2	82998031	missense	possibly damaging	0.92
R1025:Fsip2	UTSW	2	82989436	nonsense	probably null
R1026:Fsip2	UTSW	2	82988461	missense	possibly damaging	0.52
R1140:Fsip2	UTSW	2	82975034	missense	probably damaging	0.99
R1170:Fsip2	UTSW	2	82991500	missense	possibly damaging	0.72
R1180:Fsip2	UTSW	2	82975226	missense	probably damaging	0.99
R1188:Fsip2	UTSW	2	82975017	missense	possibly damaging	0.96
R1226:Fsip2	UTSW	2	82981011	missense	probably damaging	0.96
R1248:Fsip2	UTSW	2	82989763	missense	possibly damaging	0.93
R1273:Fsip2	UTSW	2	82989408	missense	possibly damaging	0.92
R1323:Fsip2	UTSW	2	82985752	missense	probably damaging	1.00
R1323:Fsip2	UTSW	2	82985752	missense	probably damaging	1.00
R1356:Fsip2	UTSW	2	82989745	missense	probably benign	0.38
R1413:Fsip2	UTSW	2	82988418	missense	possibly damaging	0.93
R1430:Fsip2	UTSW	2	82998063	missense	possibly damaging	0.71
R1475:Fsip2	UTSW	2	82987195	missense	probably damaging	0.99
R1489:Fsip2	UTSW	2	82979811	missense	probably benign
R1520:Fsip2	UTSW	2	82980714	missense	possibly damaging	0.96
R1543:Fsip2	UTSW	2	82981587	missense	possibly damaging	0.91
R1581:Fsip2	UTSW	2	82986282	missense	probably damaging	0.98
R1590:Fsip2	UTSW	2	82982787	missense	probably benign	0.26
R1646:Fsip2	UTSW	2	82978517	missense	probably benign	0.07
R1678:Fsip2	UTSW	2	82986345	missense	probably benign
R1700:Fsip2	UTSW	2	82991737	missense	probably benign	0.33
R1717:Fsip2	UTSW	2	82974945	missense	possibly damaging	0.68
R1741:Fsip2	UTSW	2	82989912	missense	probably benign	0.32
R1760:Fsip2	UTSW	2	82984896	missense	probably benign	0.07
R1760:Fsip2	UTSW	2	82987711	missense	possibly damaging	0.71
R1760:Fsip2	UTSW	2	82999841	missense	possibly damaging	0.85
R1789:Fsip2	UTSW	2	82977562	missense	probably benign	0.00
R1850:Fsip2	UTSW	2	82984589	missense	possibly damaging	0.72
R1854:Fsip2	UTSW	2	82993257	missense	possibly damaging	0.84
R1888:Fsip2	UTSW	2	82944160	missense	probably benign	0.04
R1888:Fsip2	UTSW	2	82944160	missense	probably benign	0.04
R1905:Fsip2	UTSW	2	82983428	missense	possibly damaging	0.93
R1907:Fsip2	UTSW	2	82983428	missense	possibly damaging	0.93
R1920:Fsip2	UTSW	2	82986820	missense	probably benign	0.04
R1921:Fsip2	UTSW	2	82980783	nonsense	probably null
R1921:Fsip2	UTSW	2	82986820	missense	probably benign	0.04
R1931:Fsip2	UTSW	2	82986733	missense	probably damaging	0.99
R1934:Fsip2	UTSW	2	82980558	missense	possibly damaging	0.91
R1959:Fsip2	UTSW	2	82991550	missense	probably benign
R1965:Fsip2	UTSW	2	82992780	missense	possibly damaging	0.86
R1966:Fsip2	UTSW	2	82992780	missense	possibly damaging	0.86
R1983:Fsip2	UTSW	2	82979831	missense	probably benign
R1988:Fsip2	UTSW	2	82976517	missense	possibly damaging	0.56
R2016:Fsip2	UTSW	2	82982732	missense	possibly damaging	0.53
R2017:Fsip2	UTSW	2	82982732	missense	possibly damaging	0.53
R2026:Fsip2	UTSW	2	82989444	missense	possibly damaging	0.71
R2034:Fsip2	UTSW	2	82989494	missense	probably benign	0.43
R2037:Fsip2	UTSW	2	82978512	missense	probably damaging	0.99
R2070:Fsip2	UTSW	2	82976355	missense	probably damaging	0.98
R2072:Fsip2	UTSW	2	83008815	missense	possibly damaging	0.53
R2075:Fsip2	UTSW	2	82988579	missense	possibly damaging	0.85
R2143:Fsip2	UTSW	2	82990271	missense	possibly damaging	0.93
R2207:Fsip2	UTSW	2	82977479	missense	probably benign	0.02
R2256:Fsip2	UTSW	2	82962751	missense	probably benign	0.07
R2315:Fsip2	UTSW	2	82975093	missense	probably benign
R2344:Fsip2	UTSW	2	82989913	missense	possibly damaging	0.71
R2377:Fsip2	UTSW	2	82976249	missense	probably benign	0.29
R2403:Fsip2	UTSW	2	82980720	missense	possibly damaging	0.53
R2441:Fsip2	UTSW	2	82985341	missense	possibly damaging	0.53
R2504:Fsip2	UTSW	2	82979610	missense	possibly damaging	0.86
R2510:Fsip2	UTSW	2	82986438	missense	probably benign
R2511:Fsip2	UTSW	2	82951657	missense	probably damaging	1.00
R2511:Fsip2	UTSW	2	82986438	missense	probably benign
R2512:Fsip2	UTSW	2	82978167	missense	probably benign	0.04
R2568:Fsip2	UTSW	2	82990431	missense	probably benign	0.14
R2656:Fsip2	UTSW	2	82979045	missense	possibly damaging	0.83
R2883:Fsip2	UTSW	2	82991524	missense	possibly damaging	0.86
R3417:Fsip2	UTSW	2	82986510	missense	possibly damaging	0.51
R3431:Fsip2	UTSW	2	82992010	missense	possibly damaging	0.85
R3441:Fsip2	UTSW	2	82986727	missense	probably benign	0.00
R3605:Fsip2	UTSW	2	82984909	missense	probably benign	0.28
R3620:Fsip2	UTSW	2	82980258	missense	probably benign	0.00
R3621:Fsip2	UTSW	2	82980258	missense	probably benign	0.00
R3726:Fsip2	UTSW	2	82988967	missense	possibly damaging	0.84
R3755:Fsip2	UTSW	2	82978217	missense	probably benign	0.26
R3789:Fsip2	UTSW	2	82982714	missense	probably damaging	0.96
R3836:Fsip2	UTSW	2	82950946	missense	probably damaging	1.00
R3844:Fsip2	UTSW	2	82989606	missense	possibly damaging	0.52
R3846:Fsip2	UTSW	2	82986415	missense	possibly damaging	0.52
R3861:Fsip2	UTSW	2	82984776	missense	probably damaging	0.98
R3981:Fsip2	UTSW	2	82958662	missense	probably benign	0.08
R4014:Fsip2	UTSW	2	82983518	missense	probably benign
R4042:Fsip2	UTSW	2	82983552	missense	probably benign	0.02
R4075:Fsip2	UTSW	2	82982901	missense	probably benign	0.26
R4154:Fsip2	UTSW	2	82987069	missense	possibly damaging	0.71
R4210:Fsip2	UTSW	2	82975149	missense	probably damaging	0.99
R4211:Fsip2	UTSW	2	82975149	missense	probably damaging	0.99
R4327:Fsip2	UTSW	2	82987059	missense	probably benign	0.25
R4332:Fsip2	UTSW	2	82977857	missense	probably benign	0.00
R4440:Fsip2	UTSW	2	82991206	missense	possibly damaging	0.85
R4454:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4455:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4457:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4458:Fsip2	UTSW	2	82990776	missense	possibly damaging	0.70
R4540:Fsip2	UTSW	2	82951665	missense	probably benign
R4549:Fsip2	UTSW	2	82989628	missense	probably damaging	0.99
R4558:Fsip2	UTSW	2	82984953	missense	possibly damaging	0.73
R4573:Fsip2	UTSW	2	82986166	missense	possibly damaging	0.71
R4583:Fsip2	UTSW	2	82978673	missense	probably benign	0.33
R4618:Fsip2	UTSW	2	82987759	missense	probably benign
R4700:Fsip2	UTSW	2	82987029	missense	probably benign	0.32
R4716:Fsip2	UTSW	2	82974859	missense	probably damaging	0.96
R4739:Fsip2	UTSW	2	82975353	missense	possibly damaging	0.92
R4749:Fsip2	UTSW	2	82989285	missense	probably benign	0.06
R4791:Fsip2	UTSW	2	82982108	missense	possibly damaging	0.53
R4793:Fsip2	UTSW	2	82987700	nonsense	probably null
R4819:Fsip2	UTSW	2	82988442	missense	probably benign	0.06
R4832:Fsip2	UTSW	2	82990171	missense	possibly damaging	0.92
R4840:Fsip2	UTSW	2	82949395	missense	probably benign	0.01
R4840:Fsip2	UTSW	2	82985471	missense	probably benign	0.26
R4865:Fsip2	UTSW	2	82990951	missense	possibly damaging	0.86
R4876:Fsip2	UTSW	2	82974858	missense	possibly damaging	0.91
R4885:Fsip2	UTSW	2	82988094	missense	probably benign	0.02
R4911:Fsip2	UTSW	2	82981493	missense	possibly damaging	0.85
R4918:Fsip2	UTSW	2	82993770	missense	possibly damaging	0.51
R4936:Fsip2	UTSW	2	82985040	missense	probably benign	0.18
R4950:Fsip2	UTSW	2	82946932	missense	probably damaging	0.97
R4950:Fsip2	UTSW	2	82977414	missense	probably benign	0.03
R4959:Fsip2	UTSW	2	82984825	missense	probably benign	0.00
R4971:Fsip2	UTSW	2	82985878	missense	probably benign	0.38
R4973:Fsip2	UTSW	2	82984825	missense	probably benign	0.00
R4976:Fsip2	UTSW	2	82988191	missense	probably damaging	0.99
R5022:Fsip2	UTSW	2	82979429	missense	probably benign	0.33
R5027:Fsip2	UTSW	2	82989133	missense	possibly damaging	0.71
R5030:Fsip2	UTSW	2	82988492	missense	possibly damaging	0.85
R5048:Fsip2	UTSW	2	82993150	missense	probably damaging	0.97
R5096:Fsip2	UTSW	2	82991116	missense	probably benign	0.00
R5097:Fsip2	UTSW	2	82991985	missense	probably benign
R5119:Fsip2	UTSW	2	82988191	missense	probably damaging	0.99
R5138:Fsip2	UTSW	2	82981424	missense	probably benign	0.12
R5152:Fsip2	UTSW	2	82978572	missense	probably benign	0.43
R5174:Fsip2	UTSW	2	82980741	missense	probably benign	0.07
R5193:Fsip2	UTSW	2	82982994	missense	possibly damaging	0.53
R5245:Fsip2	UTSW	2	82993161	missense	probably benign	0.02
R5282:Fsip2	UTSW	2	82978581	missense	possibly damaging	0.61
R5323:Fsip2	UTSW	2	82988145	missense	possibly damaging	0.71
R5326:Fsip2	UTSW	2	82981863	missense	possibly damaging	0.84
R5378:Fsip2	UTSW	2	82989841	missense	possibly damaging	0.71
R5380:Fsip2	UTSW	2	82975398	missense	possibly damaging	0.91
R5396:Fsip2	UTSW	2	82990918	missense	probably benign	0.00
R5422:Fsip2	UTSW	2	82982228	missense	probably benign	0.00
R5481:Fsip2	UTSW	2	82979886	missense	probably benign	0.26
R5482:Fsip2	UTSW	2	82985310	missense	possibly damaging	0.80
R5513:Fsip2	UTSW	2	82950908	missense	probably damaging	1.00
R5513:Fsip2	UTSW	2	82950912	missense	probably benign	0.07
R5513:Fsip2	UTSW	2	82985198	missense	possibly damaging	0.72
R5536:Fsip2	UTSW	2	82987059	missense	probably benign	0.25
R5542:Fsip2	UTSW	2	82981863	missense	possibly damaging	0.84
R5553:Fsip2	UTSW	2	82962746	missense	probably benign
R5568:Fsip2	UTSW	2	82986564	missense	probably benign	0.25
R5581:Fsip2	UTSW	2	82998128	missense	possibly damaging	0.84
R5664:Fsip2	UTSW	2	82988095	missense	probably benign	0.05
R5672:Fsip2	UTSW	2	82987494	nonsense	probably null
R5712:Fsip2	UTSW	2	83008848	missense	possibly damaging	0.73
R5762:Fsip2	UTSW	2	82977916	missense	probably benign	0.33
R5772:Fsip2	UTSW	2	82984740	missense	probably benign
R5881:Fsip2	UTSW	2	82984441	missense	possibly damaging	0.72
R5919:Fsip2	UTSW	2	82992609	missense	possibly damaging	0.71
R5920:Fsip2	UTSW	2	82988508	nonsense	probably null
R5934:Fsip2	UTSW	2	82986748	missense	possibly damaging	0.86
R5938:Fsip2	UTSW	2	82977491	missense	probably benign	0.00
R5974:Fsip2	UTSW	2	82963313	missense	possibly damaging	0.68
R5991:Fsip2	UTSW	2	82990468	missense	probably benign	0.28
R6019:Fsip2	UTSW	2	82987939	missense	possibly damaging	0.52
R6020:Fsip2	UTSW	2	82992127	missense	probably damaging	0.99
R6056:Fsip2	UTSW	2	82985673	missense	probably benign	0.01
R6057:Fsip2	UTSW	2	82979433	missense	probably damaging	0.99
R6139:Fsip2	UTSW	2	82991044	missense	possibly damaging	0.85
R6145:Fsip2	UTSW	2	82993768	missense	possibly damaging	0.71
R6160:Fsip2	UTSW	2	82987945	nonsense	probably null
R6161:Fsip2	UTSW	2	82987257	missense	possibly damaging	0.80
R6166:Fsip2	UTSW	2	82980727	missense	probably benign	0.00
R6187:Fsip2	UTSW	2	82982454	missense	probably benign	0.33
R6196:Fsip2	UTSW	2	82989883	missense	possibly damaging	0.71
R6217:Fsip2	UTSW	2	82988418	missense	possibly damaging	0.93
R6276:Fsip2	UTSW	2	82980441	missense	possibly damaging	0.91
R6278:Fsip2	UTSW	2	82988898	missense	probably benign	0.16
R6349:Fsip2	UTSW	2	82993072	missense	probably benign	0.05
R6351:Fsip2	UTSW	2	82992684	missense	possibly damaging	0.51
R6401:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6404:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6405:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6437:Fsip2	UTSW	2	82983492	missense	possibly damaging	0.73
R6478:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6479:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6480:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6481:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6521:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6529:Fsip2	UTSW	2	82982313	missense	probably benign
R6621:Fsip2	UTSW	2	82989814	missense	possibly damaging	0.93
R6639:Fsip2	UTSW	2	82983227	missense	possibly damaging	0.85
R6649:Fsip2	UTSW	2	82967817	missense	possibly damaging	0.83
R6714:Fsip2	UTSW	2	82979534	missense	probably benign	0.01
R6714:Fsip2	UTSW	2	82990086	missense	possibly damaging	0.71
R6749:Fsip2	UTSW	2	82978394	missense	possibly damaging	0.85
R6765:Fsip2	UTSW	2	82986432	missense	probably benign
R6790:Fsip2	UTSW	2	82990939	missense	possibly damaging	0.53
R6793:Fsip2	UTSW	2	82989494	missense	probably benign	0.43
R6795:Fsip2	UTSW	2	82980959	missense	probably benign	0.08
R6818:Fsip2	UTSW	2	82985200	missense	probably benign	0.04
R6844:Fsip2	UTSW	2	82983625	missense	possibly damaging	0.72
R6848:Fsip2	UTSW	2	82982787	missense	probably benign	0.26
R6945:Fsip2	UTSW	2	82992840	missense	probably benign	0.16
R6950:Fsip2	UTSW	2	82985988	missense	probably benign	0.03
R6951:Fsip2	UTSW	2	82981949	missense	possibly damaging	0.68
R6974:Fsip2	UTSW	2	82978717	missense	probably damaging	0.96
R6987:Fsip2	UTSW	2	82948286	nonsense	probably null
R6989:Fsip2	UTSW	2	82976954	missense	probably benign	0.00
R7001:Fsip2	UTSW	2	82986925	missense	probably damaging	1.00
R7002:Fsip2	UTSW	2	82989343	missense	possibly damaging	0.86
R7016:Fsip2	UTSW	2	82990635	missense	probably benign	0.25
R7066:Fsip2	UTSW	2	82990891	missense	possibly damaging	0.86
R7067:Fsip2	UTSW	2	82980734	missense	possibly damaging	0.85
R7077:Fsip2	UTSW	2	82983152	missense	probably benign	0.18
R7099:Fsip2	UTSW	2	82987624	missense	probably benign
R7126:Fsip2	UTSW	2	82983141	missense	possibly damaging	0.53
R7156:Fsip2	UTSW	2	82982741	missense	probably benign	0.00
R7165:Fsip2	UTSW	2	82981197	missense	possibly damaging	0.77
R7171:Fsip2	UTSW	2	82986227	nonsense	probably null
R7189:Fsip2	UTSW	2	82993237	missense	possibly damaging	0.92
R7217:Fsip2	UTSW	2	82989068	missense	possibly damaging	0.85
R7222:Fsip2	UTSW	2	82983671	missense	probably benign
R7228:Fsip2	UTSW	2	82992307	missense	possibly damaging	0.93
R7238:Fsip2	UTSW	2	82982140	missense	possibly damaging	0.72
R7244:Fsip2	UTSW	2	82993263	missense	possibly damaging	0.92
R7251:Fsip2	UTSW	2	82979081	missense	possibly damaging	0.95
R7259:Fsip2	UTSW	2	82982130	missense	possibly damaging	0.85
R7291:Fsip2	UTSW	2	82980519	missense	possibly damaging	0.91
R7323:Fsip2	UTSW	2	82989516	missense	probably benign	0.07
R7335:Fsip2	UTSW	2	82983118	missense	probably benign
R7343:Fsip2	UTSW	2	82979367	missense	probably benign	0.07
R7346:Fsip2	UTSW	2	82998180	missense	probably benign	0.00
R7389:Fsip2	UTSW	2	82988796	missense	possibly damaging	0.51
R7391:Fsip2	UTSW	2	82990319	missense	possibly damaging	0.70
R7397:Fsip2	UTSW	2	82985257	missense	possibly damaging	0.53
R7426:Fsip2	UTSW	2	82980097	missense	probably damaging	0.98
R7450:Fsip2	UTSW	2	82951680	missense	probably benign	0.30
R7538:Fsip2	UTSW	2	82988550	missense	possibly damaging	0.86
R7542:Fsip2	UTSW	2	82984852	missense	possibly damaging	0.96
R7549:Fsip2	UTSW	2	82993993	missense	probably damaging	0.99
R7564:Fsip2	UTSW	2	82989017	missense	probably benign	0.02
R7565:Fsip2	UTSW	2	82949512	missense	probably damaging	0.97
R7583:Fsip2	UTSW	2	82975241	missense	probably benign	0.12
R7641:Fsip2	UTSW	2	82986912	nonsense	probably null
R7655:Fsip2	UTSW	2	82977542	missense	possibly damaging	0.91
R7656:Fsip2	UTSW	2	82977542	missense	possibly damaging	0.91
R7665:Fsip2	UTSW	2	82981805	missense	probably benign	0.03
R7672:Fsip2	UTSW	2	82990111	missense	possibly damaging	0.93
R7764:Fsip2	UTSW	2	82980908	missense	possibly damaging	0.93
R7790:Fsip2	UTSW	2	82988379	missense	probably benign
R7811:Fsip2	UTSW	2	82998453	missense	possibly damaging	0.93
R7838:Fsip2	UTSW	2	82976700	missense	probably benign	0.00
R7873:Fsip2	UTSW	2	82949512	missense	probably damaging	0.97
R7902:Fsip2	UTSW	2	82977824	missense	possibly damaging	0.72
R7920:Fsip2	UTSW	2	82951021	missense	possibly damaging	0.94
R7959:Fsip2	UTSW	2	82985776	missense	possibly damaging	0.51
R8009:Fsip2	UTSW	2	82988449	missense	possibly damaging	0.85
R8031:Fsip2	UTSW	2	82986891	missense	probably benign
R8034:Fsip2	UTSW	2	82989355	missense	possibly damaging	0.92
R8037:Fsip2	UTSW	2	82985978	missense	possibly damaging	0.72
R8110:Fsip2	UTSW	2	82958673	missense	probably benign	0.00
R8117:Fsip2	UTSW	2	82992952	missense	possibly damaging	0.86
R8138:Fsip2	UTSW	2	82975797	missense	possibly damaging	0.83
R8175:Fsip2	UTSW	2	82984744	missense	probably benign	0.06
R8175:Fsip2	UTSW	2	82987677	missense	probably benign	0.16
R8182:Fsip2	UTSW	2	82976607	missense	probably damaging	0.99
R8206:Fsip2	UTSW	2	82990464	missense	possibly damaging	0.85
R8229:Fsip2	UTSW	2	82978143	missense	possibly damaging	0.63
R8239:Fsip2	UTSW	2	82989343	missense	possibly damaging	0.71
R8245:Fsip2	UTSW	2	82981002	missense	possibly damaging	0.79
R8303:Fsip2	UTSW	2	82988380	missense	probably benign	0.00
R8336:Fsip2	UTSW	2	82990755	missense	possibly damaging	0.53
R8347:Fsip2	UTSW	2	82987854	missense	probably benign	0.16
R8351:Fsip2	UTSW	2	82991895	missense	possibly damaging	0.73
R8352:Fsip2	UTSW	2	82984593	missense	probably benign
R8419:Fsip2	UTSW	2	82978619	missense	probably damaging	0.96
R8431:Fsip2	UTSW	2	82981566	missense	probably damaging	1.00
R8439:Fsip2	UTSW	2	82977086	missense	probably benign	0.24
R8452:Fsip2	UTSW	2	82984593	missense	probably benign
R8459:Fsip2	UTSW	2	82979678	missense	possibly damaging	0.95
R8465:Fsip2	UTSW	2	82979940	missense	probably benign	0.26
R8473:Fsip2	UTSW	2	82946992	missense	probably damaging	0.99
R8703:Fsip2	UTSW	2	82991527	missense	probably damaging	0.98
R8711:Fsip2	UTSW	2	82984902	missense	possibly damaging	0.53
R8713:Fsip2	UTSW	2	82981109	missense	probably damaging	1.00
R8789:Fsip2	UTSW	2	82985478	missense	possibly damaging	0.73
R8805:Fsip2	UTSW	2	82983109	missense	possibly damaging	0.46
R8840:Fsip2	UTSW	2	82991262	missense	probably benign	0.03
R8855:Fsip2	UTSW	2	82980177	missense	probably benign	0.04
R8866:Fsip2	UTSW	2	82980177	missense	probably benign	0.04
R8875:Fsip2	UTSW	2	82990438	missense	possibly damaging	0.95
R8883:Fsip2	UTSW	2	82979180	missense	possibly damaging	0.68
R8903:Fsip2	UTSW	2	82977337	missense	possibly damaging	0.83
R8907:Fsip2	UTSW	2	82986640	missense	probably benign	0.20
R8912:Fsip2	UTSW	2	82980594	missense	probably benign
R8926:Fsip2	UTSW	2	82993583	missense	possibly damaging	0.84
R8991:Fsip2	UTSW	2	82985026	missense	probably benign	0.33
R9014:Fsip2	UTSW	2	82976554	missense	probably benign	0.32
R9014:Fsip2	UTSW	2	82986731	missense	possibly damaging	0.71
R9039:Fsip2	UTSW	2	82998201	missense	probably benign	0.32
R9054:Fsip2	UTSW	2	82975836	missense	possibly damaging	0.68
R9114:Fsip2	UTSW	2	82976957	missense	probably benign	0.00
R9124:Fsip2	UTSW	2	82985759	missense	probably benign	0.00
R9131:Fsip2	UTSW	2	82982826	missense	probably benign
R9149:Fsip2	UTSW	2	82982030	missense	possibly damaging	0.86
R9180:Fsip2	UTSW	2	82985230	missense	possibly damaging	0.96
R9192:Fsip2	UTSW	2	82987500	missense	probably benign	0.06
R9216:Fsip2	UTSW	2	82990081	missense	probably damaging	0.99
R9218:Fsip2	UTSW	2	82992718	missense	probably damaging	0.97
R9222:Fsip2	UTSW	2	82985614	missense	probably benign	0.00
R9262:Fsip2	UTSW	2	82977318	missense	probably benign	0.00
R9340:Fsip2	UTSW	2	82988260	missense	possibly damaging	0.71
R9342:Fsip2	UTSW	2	82988403	missense	possibly damaging	0.71
R9368:Fsip2	UTSW	2	82980695	missense	possibly damaging	0.68
R9372:Fsip2	UTSW	2	82992412	missense	possibly damaging	0.71
R9385:Fsip2	UTSW	2	82989449	missense	possibly damaging	0.84
R9432:Fsip2	UTSW	2	82975563	missense	probably damaging	0.98
R9434:Fsip2	UTSW	2	82986358	missense	possibly damaging	0.71
R9445:Fsip2	UTSW	2	82975788	missense	probably damaging	0.99
R9472:Fsip2	UTSW	2	82986941	missense	possibly damaging	0.85
R9496:Fsip2	UTSW	2	82962718	missense	probably benign
R9523:Fsip2	UTSW	2	82977628	missense	probably damaging	0.99
R9567:Fsip2	UTSW	2	82967829	missense	probably benign
R9636:Fsip2	UTSW	2	82990219	missense	possibly damaging	0.52
R9643:Fsip2	UTSW	2	82991640	missense	possibly damaging	0.53
R9680:Fsip2	UTSW	2	82988928	missense	probably benign	0.32
R9695:Fsip2	UTSW	2	82975882	missense	probably benign
R9705:Fsip2	UTSW	2	82993290	missense	probably benign
R9739:Fsip2	UTSW	2	82993552	missense	possibly damaging	0.71
R9751:Fsip2	UTSW	2	82987897	missense	probably benign	0.00
R9761:Fsip2	UTSW	2	82991650	missense	probably benign	0.00
R9798:Fsip2	UTSW	2	82979881	nonsense	probably null
RF003:Fsip2	UTSW	2	82991521	missense	probably benign	0.02
RF005:Fsip2	UTSW	2	82992532	missense	probably benign	0.04
RF008:Fsip2	UTSW	2	82977840	missense	probably benign
RF028:Fsip2	UTSW	2	82994008	frame shift	probably null
RF029:Fsip2	UTSW	2	82994008	frame shift	probably null
RF036:Fsip2	UTSW	2	82984363	critical splice acceptor site	probably benign
RF038:Fsip2	UTSW	2	82994008	frame shift	probably null
RF062:Fsip2	UTSW	2	82984363	critical splice acceptor site	probably benign
X0018:Fsip2	UTSW	2	82982507	nonsense	probably null
X0020:Fsip2	UTSW	2	82951020	missense	probably damaging	1.00
X0025:Fsip2	UTSW	2	82954946	missense	possibly damaging	0.70
X0027:Fsip2	UTSW	2	82976778	missense	probably benign	0.35
X0066:Fsip2	UTSW	2	82987463	missense	possibly damaging	0.51
Z1088:Fsip2	UTSW	2	82975448	missense	probably damaging	0.96
Z1088:Fsip2	UTSW	2	82987653	missense	possibly damaging	0.86
Z1088:Fsip2	UTSW	2	82988634	missense	possibly damaging	0.85
Z1176:Fsip2	UTSW	2	82989665	missense	probably benign	0.02
Z1177:Fsip2	UTSW	2	82946960	missense	probably damaging	0.99
Z1177:Fsip2	UTSW	2	82984524	missense	probably damaging	0.98
Z1177:Fsip2	UTSW	2	82987203	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- TGCAGAGGATACAGCCAGTATG -3'
(R):5'- AGCTAAGCTTACAATTTCTGCC -3'

Sequencing Primer
(F):5'- ACAGCCAGTATGATATATGAAACAAC -3'
(R):5'- AAGCTTACAATTTCTGCCTCTGG -3'

Posted On

2019-06-26