Incidental Mutation 'R7316:Cdan1'
ID567942
Institutional Source Beutler Lab
Gene Symbol Cdan1
Ensembl Gene ENSMUSG00000027284
Gene Namecongenital dyserythropoietic anemia, type I (human)
Synonymscodanin-1, CDA-I, CDA1, 1500015A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7316 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120716154-120850128 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 120728332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]
Predicted Effect probably benign
Transcript: ENSMUST00000028740
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057135
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085840
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110700
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110701
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Pcnx T C 12: 81,995,549 S38P probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Cdan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Cdan1 APN 2 120725985 missense probably damaging 1.00
IGL01660:Cdan1 APN 2 120725653 missense possibly damaging 0.63
IGL01930:Cdan1 APN 2 120726582 intron probably benign
IGL02597:Cdan1 APN 2 120725239 missense probably benign 0.08
IGL03025:Cdan1 APN 2 120730741 missense probably damaging 1.00
IGL03130:Cdan1 APN 2 120727912 missense possibly damaging 0.94
IGL03388:Cdan1 APN 2 120730511 utr 3 prime probably benign
FR4737:Cdan1 UTSW 2 120724971 missense probably damaging 0.96
R0001:Cdan1 UTSW 2 120723751 missense probably benign 0.41
R0650:Cdan1 UTSW 2 120726045 missense probably benign 0.00
R0781:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R0881:Cdan1 UTSW 2 120720985 missense probably damaging 1.00
R1110:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R1345:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1370:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1503:Cdan1 UTSW 2 120729575 missense probably damaging 1.00
R1579:Cdan1 UTSW 2 120730739 missense probably damaging 0.98
R1664:Cdan1 UTSW 2 120720506 missense probably damaging 0.99
R1749:Cdan1 UTSW 2 120729799 missense probably damaging 0.96
R1765:Cdan1 UTSW 2 120720749 missense probably damaging 1.00
R1806:Cdan1 UTSW 2 120731426 utr 3 prime probably benign
R1856:Cdan1 UTSW 2 120724936 missense probably benign
R2202:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2203:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2204:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120725632 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120731020 utr 3 prime probably benign
R4060:Cdan1 UTSW 2 120725743 missense probably benign 0.00
R4324:Cdan1 UTSW 2 120724979 missense probably damaging 0.97
R4379:Cdan1 UTSW 2 120726618 missense probably damaging 1.00
R4611:Cdan1 UTSW 2 120730720 missense probably damaging 0.96
R4695:Cdan1 UTSW 2 120728383 missense probably damaging 1.00
R4866:Cdan1 UTSW 2 120731447 utr 3 prime probably benign
R5183:Cdan1 UTSW 2 120729580 missense probably damaging 0.96
R5347:Cdan1 UTSW 2 120730065 missense possibly damaging 0.95
R5789:Cdan1 UTSW 2 120729535 missense probably benign 0.22
R5958:Cdan1 UTSW 2 120723902 missense possibly damaging 0.80
R6608:Cdan1 UTSW 2 120726680 missense possibly damaging 0.78
R7055:Cdan1 UTSW 2 120727861 missense probably damaging 0.97
R7065:Cdan1 UTSW 2 120718921 missense probably benign 0.00
R7225:Cdan1 UTSW 2 120724912 missense probably benign
R7238:Cdan1 UTSW 2 120730302 missense probably benign
R7325:Cdan1 UTSW 2 120724704 missense probably benign 0.25
R7432:Cdan1 UTSW 2 120722755 missense probably damaging 1.00
R7517:Cdan1 UTSW 2 120727924 missense probably damaging 1.00
R7691:Cdan1 UTSW 2 120729567 missense probably damaging 1.00
R8004:Cdan1 UTSW 2 120731443 missense unknown
R8324:Cdan1 UTSW 2 120727325 missense probably benign 0.07
R8465:Cdan1 UTSW 2 120728440 missense possibly damaging 0.93
R8556:Cdan1 UTSW 2 120722990 missense probably damaging 1.00
X0050:Cdan1 UTSW 2 120724145 missense probably benign 0.29
Z1088:Cdan1 UTSW 2 120730336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTGGACAGGGAAAGCTG -3'
(R):5'- CAGTTTCCATGGTGCTGTCAGG -3'

Sequencing Primer
(F):5'- CTAAGATGGTCGGCTAAGCTC -3'
(R):5'- TGTCAGGTGGGCAGACTC -3'
Posted On2019-06-26