Incidental Mutation 'R7316:Asph'
ID567946
Institutional Source Beutler Lab
Gene Symbol Asph
Ensembl Gene ENSMUSG00000028207
Gene Nameaspartate-beta-hydroxylase
Synonymsaspartyl beta-hydroxylase, BAH, calsequestrin-binding protein, jumbug, 2310005F16Rik, 3110001L23Rik, junctate, cI-37, Junctin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7316 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location9448069-9669344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9537746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 344 (V344A)
Ref Sequence ENSEMBL: ENSMUSP00000077273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078139] [ENSMUST00000108339] [ENSMUST00000108340]
Predicted Effect probably benign
Transcript: ENSMUST00000078139
AA Change: V344A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: V344A

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 7e-104 PFAM
Pfam:TPR_6 326 357 4.4e-5 PFAM
Pfam:TPR_16 328 398 1.3e-9 PFAM
Pfam:TPR_2 439 470 2.6e-4 PFAM
Pfam:TPR_8 441 470 1.7e-3 PFAM
Pfam:Asp_Arg_Hydrox 574 728 7.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108339
AA Change: V261A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207
AA Change: V261A

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 224 1.6e-80 PFAM
Pfam:TPR_6 243 274 1.4e-4 PFAM
Pfam:TPR_16 245 315 2.5e-9 PFAM
Pfam:TPR_2 356 387 7e-4 PFAM
Pfam:Asp_Arg_Hydrox 489 646 5.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108340
AA Change: V328A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207
AA Change: V328A

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 8.6e-96 PFAM
Pfam:TPR_6 310 341 1.9e-4 PFAM
Pfam:TPR_16 312 382 2.9e-9 PFAM
Pfam:TPR_2 423 454 6.8e-4 PFAM
Pfam:Asp_Arg_Hydrox 556 713 3.8e-64 PFAM
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Pcnx T C 12: 81,995,549 S38P probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Asph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Asph APN 4 9639322 missense probably damaging 1.00
IGL00928:Asph APN 4 9594675 missense probably benign 0.07
IGL01022:Asph APN 4 9601344 missense possibly damaging 0.63
IGL01677:Asph APN 4 9607853 missense probably damaging 1.00
IGL01907:Asph APN 4 9514643 missense possibly damaging 0.59
IGL01958:Asph APN 4 9474904 missense possibly damaging 0.93
IGL01976:Asph APN 4 9475471 missense probably damaging 0.98
IGL01989:Asph APN 4 9602462 splice site probably benign
IGL02379:Asph APN 4 9474980 missense probably damaging 1.00
IGL02444:Asph APN 4 9542319 splice site probably benign
IGL02652:Asph APN 4 9529984 missense probably benign 0.11
IGL02679:Asph APN 4 9601349 missense possibly damaging 0.63
IGL02735:Asph APN 4 9598759 missense probably damaging 1.00
IGL02875:Asph APN 4 9595380 missense probably damaging 1.00
IGL03022:Asph APN 4 9517668 missense possibly damaging 0.48
R0026:Asph UTSW 4 9601361 missense probably damaging 0.97
R0121:Asph UTSW 4 9635918 missense probably damaging 1.00
R0357:Asph UTSW 4 9453314 missense probably benign 0.01
R0410:Asph UTSW 4 9595415 missense probably damaging 1.00
R0554:Asph UTSW 4 9604581 missense probably damaging 0.99
R0577:Asph UTSW 4 9604620 missense probably benign 0.02
R0718:Asph UTSW 4 9514683 splice site probably benign
R0725:Asph UTSW 4 9542275 missense probably damaging 1.00
R1383:Asph UTSW 4 9537807 splice site probably null
R1654:Asph UTSW 4 9453315 missense probably benign 0.31
R1694:Asph UTSW 4 9610869 missense probably damaging 0.99
R1771:Asph UTSW 4 9598773 missense probably damaging 0.99
R1776:Asph UTSW 4 9598773 missense probably damaging 0.99
R1840:Asph UTSW 4 9601340 missense possibly damaging 0.60
R1911:Asph UTSW 4 9453335 missense probably damaging 1.00
R1912:Asph UTSW 4 9453335 missense probably damaging 1.00
R2117:Asph UTSW 4 9517671 nonsense probably null
R2860:Asph UTSW 4 9598277 missense probably damaging 1.00
R2861:Asph UTSW 4 9598277 missense probably damaging 1.00
R2937:Asph UTSW 4 9542314 splice site probably benign
R3907:Asph UTSW 4 9474934 missense probably benign 0.23
R4154:Asph UTSW 4 9639250 nonsense probably null
R4623:Asph UTSW 4 9622005 missense possibly damaging 0.50
R4871:Asph UTSW 4 9531968 missense probably benign 0.02
R5196:Asph UTSW 4 9607830 missense probably damaging 0.99
R5540:Asph UTSW 4 9635906 missense probably damaging 1.00
R5757:Asph UTSW 4 9637722 splice site probably null
R6063:Asph UTSW 4 9531960 missense probably benign 0.05
R6072:Asph UTSW 4 9643533 critical splice donor site probably null
R7016:Asph UTSW 4 9630604 splice site probably null
R7133:Asph UTSW 4 9484575 missense probably benign 0.01
R7154:Asph UTSW 4 9630930 missense possibly damaging 0.85
R7201:Asph UTSW 4 9474917 missense probably damaging 1.00
R7455:Asph UTSW 4 9531732 splice site probably null
R7516:Asph UTSW 4 9630940 missense possibly damaging 0.92
R7517:Asph UTSW 4 9517697 missense probably damaging 1.00
R7736:Asph UTSW 4 9621930 missense possibly damaging 0.81
R7818:Asph UTSW 4 9475015 missense probably damaging 1.00
R8356:Asph UTSW 4 9537722 missense probably benign 0.04
R8456:Asph UTSW 4 9537722 missense probably benign 0.04
Z1088:Asph UTSW 4 9630715 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAGCACACAGTATTGAAAACAGCC -3'
(R):5'- TGCTACTTAACATTGCTTGGGG -3'

Sequencing Primer
(F):5'- CAATTCTGGGGGTGTATGTATATAAC -3'
(R):5'- CTACTTAACATTGCTTGGGGTTTTTG -3'
Posted On2019-06-26