Incidental Mutation 'R0638:P2ry14'
ID56796
Institutional Source Beutler Lab
Gene Symbol P2ry14
Ensembl Gene ENSMUSG00000036381
Gene Namepurinergic receptor P2Y, G-protein coupled, 14
SynonymsGpr105, P2Y14, A330108O13Rik
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0638 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59113855-59153618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59115448 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 206 (V206A)
Ref Sequence ENSEMBL: ENSMUSP00000142934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000065220] [ENSMUST00000091112] [ENSMUST00000164225] [ENSMUST00000196081] [ENSMUST00000197220] [ENSMUST00000197841] [ENSMUST00000198838] [ENSMUST00000199659] [ENSMUST00000200358] [ENSMUST00000200673]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065220
AA Change: V197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066669
Gene: ENSMUSG00000036381
AA Change: V197A

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091112
AA Change: V197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088642
Gene: ENSMUSG00000036381
AA Change: V197A

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 4.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196081
AA Change: V197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142601
Gene: ENSMUSG00000036381
AA Change: V197A

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197220
AA Change: V197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143070
Gene: ENSMUSG00000036381
AA Change: V197A

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197841
AA Change: V206A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142934
Gene: ENSMUSG00000036381
AA Change: V206A

DomainStartEndE-ValueType
Pfam:7tm_1 49 304 1.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198838
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200358
SMART Domains Protein: ENSMUSP00000142641
Gene: ENSMUSG00000036381

DomainStartEndE-ValueType
Pfam:7tm_1 39 110 8.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200673
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors, which contains several receptor subtypes with different pharmacological selectivity for various adenosine and uridine nucleotides. This receptor is a P2Y purinergic receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. It has been implicated in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to exhibit increased glucose mediated forestomach muscle tension. Mice homozygous for a different null allele show decreased gastrointestinal emptying, impaired glucose tolerance, decreased glucose-stimulated insulin release, and reduced airway responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in P2ry14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:P2ry14 APN 3 59115335 missense probably damaging 1.00
R0091:P2ry14 UTSW 3 59115893 missense probably benign 0.01
R0511:P2ry14 UTSW 3 59116028 missense possibly damaging 0.89
R0518:P2ry14 UTSW 3 59115204 missense probably damaging 1.00
R1167:P2ry14 UTSW 3 59115131 missense probably damaging 0.99
R1540:P2ry14 UTSW 3 59115265 missense probably benign 0.08
R1795:P2ry14 UTSW 3 59115853 missense probably damaging 1.00
R2025:P2ry14 UTSW 3 59115445 missense probably damaging 1.00
R2096:P2ry14 UTSW 3 59115317 missense probably damaging 1.00
R2265:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R2266:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R2267:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R4664:P2ry14 UTSW 3 59115142 missense probably damaging 1.00
R5294:P2ry14 UTSW 3 59115568 missense possibly damaging 0.93
R5721:P2ry14 UTSW 3 59115031 splice site probably null
R5969:P2ry14 UTSW 3 59115158 missense probably damaging 1.00
R6077:P2ry14 UTSW 3 59115377 missense probably damaging 0.99
R6619:P2ry14 UTSW 3 59115733 missense probably damaging 1.00
R7222:P2ry14 UTSW 3 59115382 missense probably benign 0.00
R7452:P2ry14 UTSW 3 59116045 missense probably benign
R8092:P2ry14 UTSW 3 59115446 missense probably damaging 1.00
RF017:P2ry14 UTSW 3 59115046 missense probably benign 0.03
Z1176:P2ry14 UTSW 3 59115737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGCATAGAGCAGGGTCTCCTTC -3'
(R):5'- TGTGCAGTCGGTGAACTATAGCAAG -3'

Sequencing Primer
(F):5'- GTAGTGACCTTCCGTCTGAC -3'
(R):5'- GGTGAACTATAGCAAGCTGCTTTC -3'
Posted On2013-07-11