Incidental Mutation 'R7316:Mast3'
ID 567974
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 045413-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7316 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71232432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1182 (I1182F)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: I1198F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I1198F

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: I1182F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 89,969,020 (GRCm39) M214I probably benign Het
Aadat G T 8: 60,979,668 (GRCm39) G177C probably damaging Het
Adam4 T C 12: 81,466,498 (GRCm39) I708V probably benign Het
Aip T C 19: 4,164,793 (GRCm39) N264S probably benign Het
Alox8 A T 11: 69,077,064 (GRCm39) D505E probably benign Het
Ap3d1 A T 10: 80,553,693 (GRCm39) I518N probably damaging Het
Arf3 G A 15: 98,638,874 (GRCm39) Q128* probably null Het
Asph A G 4: 9,537,746 (GRCm39) V344A probably benign Het
Birc6 A T 17: 74,911,489 (GRCm39) R1500S probably damaging Het
Bptf G A 11: 106,963,935 (GRCm39) T1753I probably damaging Het
Bptf A T 11: 107,001,740 (GRCm39) C457* probably null Het
Brpf3 T A 17: 29,033,660 (GRCm39) I568N probably damaging Het
Btnl4 G C 17: 34,688,031 (GRCm39) N582K probably benign Het
Camsap3 C A 8: 3,654,648 (GRCm39) P773T possibly damaging Het
Capsl A T 15: 9,461,888 (GRCm39) I95L probably benign Het
Cd96 T A 16: 45,890,016 (GRCm39) M336L probably benign Het
Cdan1 A T 2: 120,558,813 (GRCm39) probably null Het
Chd3 A T 11: 69,236,394 (GRCm39) L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 (GRCm39) Y469F probably benign Het
Cp T C 3: 20,026,916 (GRCm39) L448P probably damaging Het
Csnk1g2 T C 10: 80,475,687 (GRCm39) V418A possibly damaging Het
Dag1 A T 9: 108,086,701 (GRCm39) S147T probably benign Het
Dnajc25 T A 4: 59,017,693 (GRCm39) Y117* probably null Het
Dpysl2 A T 14: 67,100,044 (GRCm39) M64K possibly damaging Het
Dus3l A G 17: 57,072,551 (GRCm39) H38R possibly damaging Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Enox1 A T 14: 77,958,298 (GRCm39) M616L probably benign Het
Epb41l4b T A 4: 57,019,867 (GRCm39) T708S probably benign Het
Fat2 A T 11: 55,176,893 (GRCm39) I1534N probably damaging Het
Fer1l5 A G 1: 36,457,197 (GRCm39) T1649A probably benign Het
Fmo9 A G 1: 166,491,215 (GRCm39) V421A probably benign Het
Fsip2 A C 2: 82,820,035 (GRCm39) Y5256S possibly damaging Het
Gapvd1 G A 2: 34,594,681 (GRCm39) L804F probably damaging Het
Garin1a A G 6: 29,286,101 (GRCm39) M187V probably benign Het
Gen1 A G 12: 11,291,470 (GRCm39) V838A probably benign Het
Gnptab A T 10: 88,236,572 (GRCm39) N59I probably damaging Het
Grm5 A G 7: 87,624,473 (GRCm39) T347A probably benign Het
Gsdmc3 T C 15: 63,730,251 (GRCm39) N438D possibly damaging Het
Hmcn1 A G 1: 150,608,697 (GRCm39) L1495S probably damaging Het
Ift70a1 A T 2: 75,811,201 (GRCm39) L294Q probably damaging Het
Islr2 T C 9: 58,105,250 (GRCm39) E714G probably damaging Het
Larp4 A T 15: 99,898,898 (GRCm39) M430L probably benign Het
Lpcat2b A G 5: 107,580,979 (GRCm39) I103V not run Het
Lrguk C T 6: 34,080,191 (GRCm39) S1142F unknown Het
Lrit2 G T 14: 36,790,815 (GRCm39) V165F probably damaging Het
Mcm6 C T 1: 128,287,245 (GRCm39) D20N probably damaging Het
Mief1 A G 15: 80,133,598 (GRCm39) I218M probably damaging Het
Mmp2 A G 8: 93,567,038 (GRCm39) T453A probably benign Het
Ms4a18 T A 19: 10,979,360 (GRCm39) S219C probably damaging Het
Myo5c A T 9: 75,176,920 (GRCm39) T622S probably benign Het
Neb A T 2: 52,161,450 (GRCm39) M2114K possibly damaging Het
Nemp1 T A 10: 127,525,212 (GRCm39) L122* probably null Het
Nkx2-1 T C 12: 56,581,583 (GRCm39) N88S probably benign Het
Nr2c2 T A 6: 92,131,444 (GRCm39) C202S probably damaging Het
Ntsr1 A C 2: 180,142,545 (GRCm39) D112A probably damaging Het
Or14j3 A G 17: 37,901,026 (GRCm39) S73P probably damaging Het
Or56a41 A T 7: 104,740,107 (GRCm39) H246Q probably damaging Het
Or6n2 A T 1: 173,897,727 (GRCm39) I288F probably benign Het
Osbp2 C A 11: 3,676,431 (GRCm39) R73L probably damaging Het
Pbp2 T A 6: 135,286,830 (GRCm39) E172D probably damaging Het
Pcdhgc3 T C 18: 37,941,501 (GRCm39) I634T probably benign Het
Pcnx1 T C 12: 82,042,323 (GRCm39) S38P probably benign Het
Phyh A T 2: 4,940,855 (GRCm39) K252* probably null Het
Plcb3 C T 19: 6,943,753 (GRCm39) probably null Het
Ppargc1b T C 18: 61,440,909 (GRCm39) S670G probably damaging Het
Prorp A G 12: 55,351,429 (GRCm39) D246G probably damaging Het
Ptprc T C 1: 137,992,509 (GRCm39) Y1067C probably damaging Het
Pwwp2b A C 7: 138,836,140 (GRCm39) E527A probably benign Het
Pzp T C 6: 128,490,736 (GRCm39) D409G probably damaging Het
Rbfox2 A T 15: 77,016,929 (GRCm39) N148K possibly damaging Het
Resf1 T C 6: 149,228,136 (GRCm39) L394P probably damaging Het
Rps24 T C 14: 24,540,757 (GRCm39) probably benign Het
Slc35e4 T C 11: 3,862,584 (GRCm39) K202E probably damaging Het
Spata7 C T 12: 98,624,871 (GRCm39) R258W probably damaging Het
Spen A T 4: 141,204,365 (GRCm39) S1421T unknown Het
Svep1 T A 4: 58,068,763 (GRCm39) I3008F possibly damaging Het
Tbc1d1 G T 5: 64,492,620 (GRCm39) probably null Het
Thsd4 T A 9: 59,894,642 (GRCm39) H772L probably benign Het
Tle1 T C 4: 72,036,529 (GRCm39) I769V probably benign Het
Tm4sf19 T A 16: 32,226,466 (GRCm39) S127T possibly damaging Het
Tmprss9 C A 10: 80,730,813 (GRCm39) R780S probably benign Het
Tpp2 T C 1: 44,009,591 (GRCm39) V475A probably benign Het
Ttn A G 2: 76,692,509 (GRCm39) V471A Het
Ttn A T 2: 76,597,257 (GRCm39) N19885K probably damaging Het
Tub A T 7: 108,629,378 (GRCm39) T478S possibly damaging Het
Ube2q2l T C 6: 136,378,276 (GRCm39) K185E possibly damaging Het
Vmn2r88 A T 14: 51,651,712 (GRCm39) Y342F Het
Wdr18 C A 10: 79,801,059 (GRCm39) D157E probably benign Het
Xrra1 A T 7: 99,525,423 (GRCm39) probably null Het
Zc3h4 G C 7: 16,169,260 (GRCm39) G1198A unknown Het
Zfp568 A T 7: 29,721,681 (GRCm39) I209F possibly damaging Het
Zfp787 C A 7: 6,158,523 (GRCm39) probably benign Het
Zfp974 A T 7: 27,609,863 (GRCm39) Y621N possibly damaging Het
Zyg11b A G 4: 108,107,699 (GRCm39) I493T possibly damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGATGCAGCCTCCTCATGAC -3'
(R):5'- CACTGACCAATTCCTGTTGC -3'

Sequencing Primer
(F):5'- TCCTCATGACGACCAGCTCAG -3'
(R):5'- TGTTGCCCACAGACACAG -3'
Posted On 2019-06-26