Incidental Mutation 'R7316:Osbp2'
ID567986
Institutional Source Beutler Lab
Gene Symbol Osbp2
Ensembl Gene ENSMUSG00000020435
Gene Nameoxysterol binding protein 2
SynonymsOSBPL1, 1700095P05Rik, C630001G20Rik, ORP-4
MMRRC Submission
Accession Numbers

Genbank: NM_152818; MGI: 1921559

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7316 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3703731-3863903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3726431 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 73 (R73L)
Ref Sequence ENSEMBL: ENSMUSP00000116361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070552] [ENSMUST00000101632] [ENSMUST00000102950] [ENSMUST00000127371] [ENSMUST00000155197]
Predicted Effect probably damaging
Transcript: ENSMUST00000070552
AA Change: R330L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068652
Gene: ENSMUSG00000020435
AA Change: R330L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
PH 180 273 1.12e-16 SMART
low complexity region 281 311 N/A INTRINSIC
Blast:PH 312 394 1e-32 BLAST
low complexity region 424 437 N/A INTRINSIC
Pfam:Oxysterol_BP 519 894 3.5e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101632
SMART Domains Protein: ENSMUSP00000099156
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Oxysterol_BP 108 484 2.1e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102950
SMART Domains Protein: ENSMUSP00000100015
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 66 442 2.8e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127371
AA Change: R73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116361
Gene: ENSMUSG00000020435
AA Change: R73L

DomainStartEndE-ValueType
low complexity region 24 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
Blast:PH 55 137 8e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155197
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the oxysterol-binding protein-related family of proteins, which are defined by a C-terminal sterol domain with a highly conserved EQVSHHPP motif. Oxysterols are oxygenated derivatives of cholesterol that are involved in mechanisms that include apoptosis, cholesterol homeostasis, lipid trafficking and cell differentiation. This protein is selectively expressed at high levels in the brain and testis. Within the testis, the mRNA is localized to postmeiotic germ cells, including spermatids and spermatozoa, but is not detectable in somatic cells. Mice homozygous mutant for a targeted deletion in this gene do not exhibit overt developmental phenotypes but are male sterile. Females display normal fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with sperm defects including oligozoospermia, teratozoospermia, asthenozoospermia and abnormal spermiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Pcnx T C 12: 81,995,549 S38P probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Osbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Osbp2 APN 11 3711848 missense probably benign 0.02
IGL00231:Osbp2 APN 11 3726561 missense possibly damaging 0.79
IGL01023:Osbp2 APN 11 3863387 missense probably benign
IGL01819:Osbp2 APN 11 3717127 missense probably damaging 1.00
IGL01931:Osbp2 APN 11 3705388 critical splice donor site probably null
IGL01933:Osbp2 APN 11 3712016 missense probably damaging 1.00
IGL02166:Osbp2 APN 11 3717983 missense probably damaging 1.00
IGL02751:Osbp2 APN 11 3863434 missense probably benign 0.20
IGL02812:Osbp2 APN 11 3714637 missense probably benign 0.00
IGL03289:Osbp2 APN 11 3863380 missense probably benign
3-1:Osbp2 UTSW 11 3863470 missense probably benign 0.11
R0035:Osbp2 UTSW 11 3717997 splice site probably benign
R0109:Osbp2 UTSW 11 3711791 missense probably benign 0.00
R0414:Osbp2 UTSW 11 3819932 missense probably damaging 1.00
R0491:Osbp2 UTSW 11 3714709 missense probably damaging 1.00
R0791:Osbp2 UTSW 11 3711882 splice site probably benign
R1473:Osbp2 UTSW 11 3717175 splice site probably null
R1630:Osbp2 UTSW 11 3717167 missense probably benign 0.15
R1931:Osbp2 UTSW 11 3726333 splice site probably null
R2697:Osbp2 UTSW 11 3863407 missense probably benign 0.00
R3799:Osbp2 UTSW 11 3717883 missense probably damaging 1.00
R4700:Osbp2 UTSW 11 3712160 missense probably damaging 1.00
R4718:Osbp2 UTSW 11 3711793 missense probably damaging 0.98
R4788:Osbp2 UTSW 11 3863320 missense probably benign 0.44
R5381:Osbp2 UTSW 11 3705593 missense probably benign 0.12
R5615:Osbp2 UTSW 11 3863356 missense probably benign 0.00
R5681:Osbp2 UTSW 11 3863486 missense probably benign
R6171:Osbp2 UTSW 11 3717221 splice site probably null
R6329:Osbp2 UTSW 11 3715153 missense probably damaging 1.00
R6861:Osbp2 UTSW 11 3715191 missense possibly damaging 0.68
R6987:Osbp2 UTSW 11 3717958 missense probably damaging 0.99
R7205:Osbp2 UTSW 11 3712134 missense probably damaging 1.00
R7540:Osbp2 UTSW 11 3717944 missense probably damaging 0.99
R7559:Osbp2 UTSW 11 3712493 missense probably damaging 1.00
R7830:Osbp2 UTSW 11 3863414 missense probably benign
R8085:Osbp2 UTSW 11 3712521 missense probably damaging 1.00
X0060:Osbp2 UTSW 11 3820035 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGGAAAGCAACTTGGAGCC -3'
(R):5'- GCTTGGTTGGTTACAGCAATTC -3'

Sequencing Primer
(F):5'- ATCCACTCAGGGTCCGGTTG -3'
(R):5'- AGCAATTCTGTTTGTCTCTTCAGATG -3'
Posted On2019-06-26