Incidental Mutation 'R7316:Chd3'
ID567990
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Namechromodomain helicase DNA binding protein 3
SynonymsChd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7316 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69343273-69369406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69345568 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1939 (L1939Q)
Ref Sequence ENSEMBL: ENSMUSP00000104301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000129321] [ENSMUST00000151617] [ENSMUST00000218008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092971
AA Change: L1905Q

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: L1905Q

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108661
AA Change: L1939Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: L1939Q

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: L1811Q

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129321
Predicted Effect probably benign
Transcript: ENSMUST00000151617
Predicted Effect probably benign
Transcript: ENSMUST00000218008
Meta Mutation Damage Score 0.6957 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Pcnx T C 12: 81,995,549 S38P probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69357062 missense probably damaging 0.96
IGL00551:Chd3 APN 11 69346629 missense probably damaging 1.00
IGL00661:Chd3 APN 11 69357383 missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69349871 missense probably damaging 0.98
IGL01075:Chd3 APN 11 69359965 missense probably damaging 1.00
IGL01309:Chd3 APN 11 69357731 missense probably damaging 0.99
IGL01317:Chd3 APN 11 69353211 missense probably damaging 1.00
IGL01374:Chd3 APN 11 69359980 missense probably damaging 0.99
IGL01444:Chd3 APN 11 69348742 missense probably benign 0.28
IGL01617:Chd3 APN 11 69358234 unclassified probably benign
IGL01635:Chd3 APN 11 69361250 splice site probably benign
IGL01942:Chd3 APN 11 69350105 critical splice donor site probably null
IGL01962:Chd3 APN 11 69357493 missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69360675 missense probably damaging 0.99
IGL02022:Chd3 APN 11 69361060 missense probably damaging 1.00
IGL02098:Chd3 APN 11 69359829 missense probably damaging 1.00
IGL02218:Chd3 APN 11 69352094 unclassified probably benign
IGL02415:Chd3 APN 11 69348913 splice site probably benign
IGL02648:Chd3 APN 11 69352150 missense probably damaging 1.00
IGL02951:Chd3 APN 11 69361048 critical splice donor site probably null
IGL03030:Chd3 APN 11 69354404 missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69361196 nonsense probably null
IGL03168:Chd3 APN 11 69348915 splice site probably benign
IGL03327:Chd3 APN 11 69350186 missense probably damaging 1.00
burg UTSW 11 69356554 missense probably damaging 1.00
Fortress UTSW 11 69364050 nonsense probably null
Redoubt UTSW 11 69353901 unclassified probably benign
schloss UTSW 11 69362060 nonsense probably null
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0056:Chd3 UTSW 11 69359913 unclassified probably benign
R0129:Chd3 UTSW 11 69348501 nonsense probably null
R0130:Chd3 UTSW 11 69359830 missense probably damaging 1.00
R0309:Chd3 UTSW 11 69357018 missense probably damaging 1.00
R0330:Chd3 UTSW 11 69356333 missense probably damaging 1.00
R0449:Chd3 UTSW 11 69357541 missense probably damaging 0.98
R0502:Chd3 UTSW 11 69354105 missense probably damaging 0.98
R0540:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0571:Chd3 UTSW 11 69361669 critical splice donor site probably null
R0607:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0616:Chd3 UTSW 11 69345487 missense probably damaging 0.96
R0630:Chd3 UTSW 11 69347195 missense probably damaging 1.00
R1436:Chd3 UTSW 11 69357574 splice site probably null
R1484:Chd3 UTSW 11 69359899 missense probably benign 0.17
R1741:Chd3 UTSW 11 69355654 missense probably damaging 1.00
R1748:Chd3 UTSW 11 69364697 missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69353901 unclassified probably benign
R1833:Chd3 UTSW 11 69354123 missense probably damaging 1.00
R2012:Chd3 UTSW 11 69349052 missense probably benign 0.01
R2101:Chd3 UTSW 11 69349051 missense probably benign
R2147:Chd3 UTSW 11 69349028 missense probably benign 0.00
R2513:Chd3 UTSW 11 69360645 missense probably damaging 1.00
R2877:Chd3 UTSW 11 69361172 nonsense probably null
R2879:Chd3 UTSW 11 69364098 missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2881:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2973:Chd3 UTSW 11 69360616 missense probably damaging 1.00
R3611:Chd3 UTSW 11 69362147 missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69364050 nonsense probably null
R3845:Chd3 UTSW 11 69346759 missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69359185 missense probably damaging 0.98
R4007:Chd3 UTSW 11 69349001 missense probably benign
R4115:Chd3 UTSW 11 69357517 missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69349877 missense probably benign 0.00
R4612:Chd3 UTSW 11 69353209 nonsense probably null
R4622:Chd3 UTSW 11 69349008 missense probably damaging 0.98
R4634:Chd3 UTSW 11 69362187 unclassified probably benign
R4635:Chd3 UTSW 11 69362187 unclassified probably benign
R4859:Chd3 UTSW 11 69359896 missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69354208 unclassified probably benign
R5173:Chd3 UTSW 11 69369243 unclassified probably benign
R5287:Chd3 UTSW 11 69349069 splice site probably null
R5403:Chd3 UTSW 11 69349069 splice site probably null
R5511:Chd3 UTSW 11 69361475 missense probably damaging 1.00
R5666:Chd3 UTSW 11 69353351 missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69361435 missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69352118 missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69349237 missense probably benign
R6211:Chd3 UTSW 11 69352677 missense probably damaging 1.00
R6215:Chd3 UTSW 11 69356554 missense probably damaging 1.00
R6217:Chd3 UTSW 11 69345535 missense probably damaging 1.00
R6302:Chd3 UTSW 11 69353778 missense probably damaging 0.98
R6329:Chd3 UTSW 11 69361684 missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69364031 missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69352545 critical splice donor site probably null
R6453:Chd3 UTSW 11 69350112 nonsense probably null
R6548:Chd3 UTSW 11 69362060 nonsense probably null
R6582:Chd3 UTSW 11 69369156 unclassified probably benign
R6721:Chd3 UTSW 11 69369219 unclassified probably benign
R6776:Chd3 UTSW 11 69354470 missense probably damaging 1.00
R6900:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69369201 missense unknown
R7136:Chd3 UTSW 11 69348438 missense probably null 0.37
R7164:Chd3 UTSW 11 69362306 missense probably damaging 1.00
R7200:Chd3 UTSW 11 69364095 missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69369211 missense unknown
R7238:Chd3 UTSW 11 69364047 missense probably benign 0.31
R7560:Chd3 UTSW 11 69356270 missense probably damaging 1.00
R7684:Chd3 UTSW 11 69357866 missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69355633 missense probably benign 0.00
R7820:Chd3 UTSW 11 69353238 missense probably damaging 1.00
R7885:Chd3 UTSW 11 69356625 missense probably benign 0.13
R8150:Chd3 UTSW 11 69363684 missense probably benign 0.02
R8161:Chd3 UTSW 11 69350885 missense probably damaging 1.00
R8271:Chd3 UTSW 11 69360657 missense probably damaging 1.00
X0022:Chd3 UTSW 11 69356258 missense probably damaging 1.00
X0062:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCACGTGCAGGATTCTGATG -3'
(R):5'- ATGTTCTGACAACCCCGACC -3'

Sequencing Primer
(F):5'- CGTGCAGGATTCTGATGGAAGG -3'
(R):5'- GCCTGTGGTCCTCTGATGTC -3'
Posted On2019-06-26