Incidental Mutation 'R0638:Crybg2'
ID56803
Institutional Source Beutler Lab
Gene Symbol Crybg2
Ensembl Gene ENSMUSG00000012123
Gene Namecrystallin beta-gamma domain containing 2
SynonymsAim1l
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R0638 (G1)
Quality Score203
Status Validated
Chromosome4
Chromosomal Location134060815-134092504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134074454 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 975 (D975G)
Ref Sequence ENSEMBL: ENSMUSP00000154159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121391] [ENSMUST00000137053] [ENSMUST00000149956] [ENSMUST00000219402] [ENSMUST00000227683]
Predicted Effect probably damaging
Transcript: ENSMUST00000121391
AA Change: D666G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114099
Gene: ENSMUSG00000012123
AA Change: D666G

DomainStartEndE-ValueType
low complexity region 171 205 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
low complexity region 414 443 N/A INTRINSIC
low complexity region 560 582 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
coiled coil region 683 703 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
XTALbg 842 921 2.56e-7 SMART
XTALbg 929 1010 9.33e-10 SMART
XTALbg 1024 1110 5.06e-29 SMART
XTALbg 1118 1199 1.4e-22 SMART
XTALbg 1212 1291 2.22e-16 SMART
XTALbg 1299 1379 1.69e-16 SMART
RICIN 1383 1514 7.89e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149504
Predicted Effect probably benign
Transcript: ENSMUST00000149956
SMART Domains Protein: ENSMUSP00000123349
Gene: ENSMUSG00000012123

DomainStartEndE-ValueType
XTALbg 1 60 1.39e-2 SMART
XTALbg 62 148 3.99e-27 SMART
XTALbg 156 237 1.4e-22 SMART
XTALbg 250 293 7.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219402
Predicted Effect probably damaging
Transcript: ENSMUST00000227683
AA Change: D975G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1855 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Crybg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Crybg2 APN 4 134075444 missense possibly damaging 0.57
IGL01147:Crybg2 APN 4 134089264 splice site probably null
IGL02003:Crybg2 APN 4 134072456 missense probably benign
IGL02468:Crybg2 APN 4 134082587 missense probably damaging 1.00
R0089:Crybg2 UTSW 4 134081194 missense probably damaging 1.00
R0414:Crybg2 UTSW 4 134072636 small deletion probably benign
R0579:Crybg2 UTSW 4 134072738 missense probably damaging 0.97
R0634:Crybg2 UTSW 4 134075304 splice site probably benign
R0686:Crybg2 UTSW 4 134074526 small deletion probably benign
R1583:Crybg2 UTSW 4 134081459 missense probably damaging 1.00
R1651:Crybg2 UTSW 4 134074825 missense possibly damaging 0.84
R1651:Crybg2 UTSW 4 134074903 missense probably benign 0.07
R1752:Crybg2 UTSW 4 134073650 missense probably damaging 0.96
R1883:Crybg2 UTSW 4 134074283 nonsense probably null
R1903:Crybg2 UTSW 4 134078856 missense probably damaging 1.00
R2042:Crybg2 UTSW 4 134087533 missense possibly damaging 0.89
R2081:Crybg2 UTSW 4 134088820 missense possibly damaging 0.82
R2229:Crybg2 UTSW 4 134074526 small deletion probably benign
R2321:Crybg2 UTSW 4 134074511 missense probably benign 0.38
R2392:Crybg2 UTSW 4 134072614 missense probably benign 0.01
R2939:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R2940:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R3028:Crybg2 UTSW 4 134073784 missense probably benign 0.19
R4458:Crybg2 UTSW 4 134074894 missense probably benign 0.32
R4487:Crybg2 UTSW 4 134074201 missense probably benign 0.00
R4680:Crybg2 UTSW 4 134072718 frame shift probably null
R4681:Crybg2 UTSW 4 134072718 frame shift probably null
R4682:Crybg2 UTSW 4 134072718 frame shift probably null
R4766:Crybg2 UTSW 4 134089352 missense probably damaging 1.00
R5079:Crybg2 UTSW 4 134074253 missense possibly damaging 0.83
R5291:Crybg2 UTSW 4 134073427 missense probably benign 0.00
R5453:Crybg2 UTSW 4 134078836 critical splice acceptor site probably null
R5711:Crybg2 UTSW 4 134082627 missense probably damaging 0.97
R5834:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R5969:Crybg2 UTSW 4 134075692 splice site probably null
R5976:Crybg2 UTSW 4 134074526 small deletion probably benign
R6022:Crybg2 UTSW 4 134074273 nonsense probably null
R6046:Crybg2 UTSW 4 134092077 missense probably damaging 1.00
R6088:Crybg2 UTSW 4 134075790 splice site probably null
R6196:Crybg2 UTSW 4 134081139 missense probably damaging 0.99
R6246:Crybg2 UTSW 4 134089346 missense probably damaging 0.96
R6303:Crybg2 UTSW 4 134087587 missense possibly damaging 0.66
R6320:Crybg2 UTSW 4 134081426 missense probably damaging 1.00
R6354:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R6737:Crybg2 UTSW 4 134072690 missense probably damaging 0.99
R6744:Crybg2 UTSW 4 134088896 missense probably damaging 1.00
R6847:Crybg2 UTSW 4 134065546 missense probably benign 0.40
R6891:Crybg2 UTSW 4 134081837 missense probably benign 0.32
R7043:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R7133:Crybg2 UTSW 4 134065443 missense probably benign 0.09
R7166:Crybg2 UTSW 4 134060882 missense probably damaging 0.96
R7412:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R7711:Crybg2 UTSW 4 134065533 missense probably benign 0.00
R7745:Crybg2 UTSW 4 134088845 missense possibly damaging 0.92
R7782:Crybg2 UTSW 4 134073826 missense probably benign 0.00
R7871:Crybg2 UTSW 4 134087599 missense probably damaging 1.00
R7943:Crybg2 UTSW 4 134072984 missense probably damaging 0.97
R8008:Crybg2 UTSW 4 134091104 missense probably damaging 1.00
R8017:Crybg2 UTSW 4 134073173 missense possibly damaging 0.95
R8391:Crybg2 UTSW 4 134075724 missense probably damaging 0.97
R8510:Crybg2 UTSW 4 134073359 missense probably benign
R8535:Crybg2 UTSW 4 134081203 missense probably damaging 1.00
R8695:Crybg2 UTSW 4 134065455 missense possibly damaging 0.55
R8789:Crybg2 UTSW 4 134074243 missense probably benign 0.00
R8870:Crybg2 UTSW 4 134091214 missense possibly damaging 0.88
X0064:Crybg2 UTSW 4 134089276 missense probably damaging 0.98
Z1176:Crybg2 UTSW 4 134082660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGTTGAAAGCCCCACCTTCC -3'
(R):5'- ATTGCCAAAGAGAAGGCTGCCTCC -3'

Sequencing Primer
(F):5'- ATCTTCTTCAGAGGCCAAGG -3'
(R):5'- GCCTTGTCCAGCTATGAGC -3'
Posted On2013-07-11