Incidental Mutation 'R7319:C87499'
ID568041
Institutional Source Beutler Lab
Gene Symbol C87499
Ensembl Gene ENSMUSG00000038330
Gene Nameexpressed sequence C87499
Synonyms
Accession Numbers

Ncbi RefSeq:NM_198663.3; MGI:2140706

Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R7319 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location88627320-88634411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88629947 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 74 (P74S)
Ref Sequence ENSEMBL: ENSMUSP00000056691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053304] [ENSMUST00000107142] [ENSMUST00000107143] [ENSMUST00000134155] [ENSMUST00000156062]
Predicted Effect probably benign
Transcript: ENSMUST00000053304
AA Change: P74S

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056691
Gene: ENSMUSG00000038330
AA Change: P74S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 425 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107142
AA Change: P74S

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000107143
AA Change: P74S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000134155
Predicted Effect probably benign
Transcript: ENSMUST00000156062
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G A 5: 90,571,766 probably null Het
9930012K11Rik A T 14: 70,156,186 I287N probably benign Het
Aco2 G T 15: 81,903,619 E223D probably damaging Het
Acsf3 T A 8: 122,813,031 I466N probably damaging Het
Aox3 T A 1: 58,152,602 F438I probably benign Het
Arhgap33 T C 7: 30,526,369 T591A probably benign Het
Ash1l C T 3: 88,981,387 A191V probably benign Het
Btg2 T C 1: 134,079,041 K5E probably benign Het
C1galt1 T A 6: 7,871,150 Y329N probably damaging Het
Cacna1h A G 17: 25,389,461 I824T possibly damaging Het
Carmil3 A G 14: 55,494,360 I182V probably benign Het
Chek1 T A 9: 36,722,643 R129W probably damaging Het
Chrna6 A G 8: 27,406,787 M354T possibly damaging Het
Cpq A G 15: 33,250,039 T181A probably benign Het
Csmd2 A T 4: 128,393,679 Y1069F Het
Defb28 T A 2: 152,520,054 C45S possibly damaging Het
Dnah1 A G 14: 31,296,594 Y1360H probably benign Het
Dnah7c T A 1: 46,780,775 D3728E probably benign Het
Dnah7c T C 1: 46,784,448 V3749A possibly damaging Het
Dym G A 18: 75,063,174 probably null Het
Dzip3 A G 16: 48,927,540 probably null Het
Eef1akmt4 A G 16: 20,617,916 K163E probably benign Het
Fbrs A G 7: 127,482,813 T242A possibly damaging Het
Fgfr3 G A 5: 33,727,802 V87M possibly damaging Het
Fst A T 13: 114,458,532 C19S probably benign Het
Gm7276 G A 18: 77,185,520 R173W unknown Het
Gm9195 G A 14: 72,460,489 H1284Y probably benign Het
Gm9573 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,622,043 probably benign Het
Herc6 C A 6: 57,604,089 T258K probably damaging Het
Hip1r A G 5: 123,999,111 Y678C probably damaging Het
Ifne A T 4: 88,880,006 N58K probably damaging Het
Ighv1-26 A T 12: 114,788,543 H60Q possibly damaging Het
Ints1 A G 5: 139,760,765 F1276L probably damaging Het
Kcnc4 T A 3: 107,458,784 E36V probably benign Het
Kcnq2 C T 2: 181,109,102 G315S probably damaging Het
Kdm4c G A 4: 74,336,963 V585M probably damaging Het
Klhl26 C T 8: 70,452,942 R106H probably damaging Het
Kmo T C 1: 175,653,655 F313S probably damaging Het
Lmtk3 T A 7: 45,794,316 S808T unknown Het
Lrch3 A G 16: 32,994,993 T585A probably benign Het
Lrch4 T A 5: 137,639,715 H86Q Het
Map3k20 A G 2: 72,364,718 D113G probably damaging Het
Mbd3l1 T C 9: 18,485,121 S181P probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Med27 A G 2: 29,413,478 R147G possibly damaging Het
Mrps5 T A 2: 127,595,842 S196R possibly damaging Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Pcdha11 C T 18: 37,013,192 P779S probably benign Het
Phykpl A G 11: 51,598,703 T379A probably benign Het
Plekha8 A C 6: 54,624,221 M270L probably benign Het
Plekhg5 A G 4: 152,108,428 H593R probably benign Het
Polr2a T C 11: 69,746,370 N293S possibly damaging Het
Prex2 T A 1: 11,162,308 N866K probably benign Het
Psme4 A T 11: 30,807,790 I308L probably benign Het
Ptprb T C 10: 116,341,404 V1003A probably benign Het
Rbbp8 T A 18: 11,732,212 D719E probably damaging Het
Rnaset2b A T 17: 6,991,767 D144V probably benign Het
Senp6 T G 9: 80,126,199 D662E probably damaging Het
Serpinb3c T C 1: 107,273,087 N200S possibly damaging Het
Serpinb9g C G 13: 33,488,560 Y113* probably null Het
Sgf29 T C 7: 126,671,649 I134T probably benign Het
Ssfa2 A T 2: 79,636,072 D82V probably damaging Het
Stab1 G A 14: 31,140,826 L2243F probably damaging Het
Sympk T C 7: 19,035,845 V149A probably benign Het
Syt3 C T 7: 44,392,529 Q271* probably null Het
Tas2r109 A G 6: 132,980,700 I89T probably benign Het
Tgif1 A G 17: 70,844,852 S255P probably damaging Het
Tnf A G 17: 35,200,371 F161S possibly damaging Het
Topaz1 T A 9: 122,750,363 S779R possibly damaging Het
Topors A G 4: 40,260,540 S915P unknown Het
Tpm4 C T 8: 72,146,477 L161F probably damaging Het
Trim38 C T 13: 23,791,401 T441I probably damaging Het
Trpv1 A G 11: 73,250,794 M548V probably benign Het
Vmn2r68 T A 7: 85,233,834 T237S probably benign Het
Wdr34 G A 2: 30,038,329 P95L probably benign Het
Zc3hav1 A G 6: 38,332,274 S538P probably benign Het
Zfp541 C T 7: 16,079,369 T649I probably benign Het
Other mutations in C87499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:C87499 APN 4 88629070 missense probably benign 0.43
IGL00229:C87499 APN 4 88629053 missense probably damaging 0.99
IGL01938:C87499 APN 4 88629363 missense possibly damaging 0.90
IGL02321:C87499 APN 4 88630103 missense probably benign 0.33
IGL02351:C87499 APN 4 88627890 missense probably damaging 1.00
IGL02358:C87499 APN 4 88627890 missense probably damaging 1.00
P0005:C87499 UTSW 4 88627950 missense probably damaging 1.00
R0521:C87499 UTSW 4 88629322 missense probably damaging 0.96
R0578:C87499 UTSW 4 88634139 missense probably benign 0.01
R0600:C87499 UTSW 4 88629299 missense probably damaging 1.00
R0750:C87499 UTSW 4 88627668 missense probably benign 0.01
R1483:C87499 UTSW 4 88628834 missense probably damaging 1.00
R1502:C87499 UTSW 4 88628032 missense probably benign 0.00
R1911:C87499 UTSW 4 88630072 missense possibly damaging 0.93
R2204:C87499 UTSW 4 88628118 missense probably damaging 0.99
R2507:C87499 UTSW 4 88629211 missense possibly damaging 0.89
R2512:C87499 UTSW 4 88628958 missense probably damaging 0.99
R4299:C87499 UTSW 4 88628182 missense probably damaging 0.97
R4498:C87499 UTSW 4 88628892 unclassified probably null
R4656:C87499 UTSW 4 88629965 missense probably benign 0.41
R4787:C87499 UTSW 4 88629213 nonsense probably null
R4823:C87499 UTSW 4 88629215 missense probably damaging 1.00
R4885:C87499 UTSW 4 88627982 missense possibly damaging 0.50
R4948:C87499 UTSW 4 88628948 missense probably damaging 1.00
R4967:C87499 UTSW 4 88629195 missense probably damaging 1.00
R5229:C87499 UTSW 4 88630135 missense possibly damaging 0.92
R5426:C87499 UTSW 4 88629410 intron probably benign
R5520:C87499 UTSW 4 88630040 missense probably damaging 1.00
R5574:C87499 UTSW 4 88628043 missense probably benign 0.10
R5596:C87499 UTSW 4 88630055 missense probably damaging 1.00
R6282:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6366:C87499 UTSW 4 88628865 missense probably damaging 0.99
R6808:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6866:C87499 UTSW 4 88627740 missense probably damaging 1.00
R7105:C87499 UTSW 4 88630102 missense probably damaging 0.98
R7117:C87499 UTSW 4 88628958 missense probably damaging 0.99
R7345:C87499 UTSW 4 88628179 missense possibly damaging 0.88
R7399:C87499 UTSW 4 88627965 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGTCCTCTCTGGCTGATGC -3'
(R):5'- GAGGAAACAATGAATGCCTACTCC -3'

Sequencing Primer
(F):5'- AAGCCTCTGATTTATGGTTGGCC -3'
(R):5'- TGAATGCCTACTCCCCACC -3'
Posted On2019-06-26