Incidental Mutation 'R7319:Topaz1'
ID568070
Institutional Source Beutler Lab
Gene Symbol Topaz1
Ensembl Gene ENSMUSG00000094985
Gene Nametestis and ovary specific PAZ domain containing 1
SynonymsGm9524
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7319 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location122747346-122802135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122750363 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 779 (S779R)
Ref Sequence ENSEMBL: ENSMUSP00000136304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178679
AA Change: S779R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136304
Gene: ENSMUSG00000094985
AA Change: S779R

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
low complexity region 236 251 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
low complexity region 1129 1139 N/A INTRINSIC
Pfam:Asp_Glu_race_2 1189 1422 3.6e-157 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (79/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with abnormal meiosis and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G A 5: 90,571,766 probably null Het
9930012K11Rik A T 14: 70,156,186 I287N probably benign Het
Aco2 G T 15: 81,903,619 E223D probably damaging Het
Acsf3 T A 8: 122,813,031 I466N probably damaging Het
Aox3 T A 1: 58,152,602 F438I probably benign Het
Arhgap33 T C 7: 30,526,369 T591A probably benign Het
Ash1l C T 3: 88,981,387 A191V probably benign Het
Btg2 T C 1: 134,079,041 K5E probably benign Het
C1galt1 T A 6: 7,871,150 Y329N probably damaging Het
C87499 G A 4: 88,629,947 P74S probably benign Het
Cacna1h A G 17: 25,389,461 I824T possibly damaging Het
Carmil3 A G 14: 55,494,360 I182V probably benign Het
Ccdc150 T A 1: 54,263,337 probably null Het
Chek1 T A 9: 36,722,643 R129W probably damaging Het
Chrna6 A G 8: 27,406,787 M354T possibly damaging Het
Cpq A G 15: 33,250,039 T181A probably benign Het
Csmd2 A T 4: 128,393,679 Y1069F Het
Defb28 T A 2: 152,520,054 C45S possibly damaging Het
Dnah1 A G 14: 31,296,594 Y1360H probably benign Het
Dnah7c T A 1: 46,780,775 D3728E probably benign Het
Dnah7c T C 1: 46,784,448 V3749A possibly damaging Het
Dym G A 18: 75,063,174 probably null Het
Dzip3 A G 16: 48,927,540 probably null Het
Eef1akmt4 A G 16: 20,617,916 K163E probably benign Het
Fbrs A G 7: 127,482,813 T242A possibly damaging Het
Fgfr3 G A 5: 33,727,802 V87M possibly damaging Het
Fst A T 13: 114,458,532 C19S probably benign Het
Gm7276 G A 18: 77,185,520 R173W unknown Het
Gm9195 G A 14: 72,460,489 H1284Y probably benign Het
Gm9573 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,622,043 probably benign Het
Herc6 C A 6: 57,604,089 T258K probably damaging Het
Hip1r A G 5: 123,999,111 Y678C probably damaging Het
Ifne A T 4: 88,880,006 N58K probably damaging Het
Ighv1-26 A T 12: 114,788,543 H60Q possibly damaging Het
Ints1 A G 5: 139,760,765 F1276L probably damaging Het
Kcnc4 T A 3: 107,458,784 E36V probably benign Het
Kcnq2 C T 2: 181,109,102 G315S probably damaging Het
Kdm4c G A 4: 74,336,963 V585M probably damaging Het
Klhl26 C T 8: 70,452,942 R106H probably damaging Het
Kmo T C 1: 175,653,655 F313S probably damaging Het
Lmtk3 T A 7: 45,794,316 S808T unknown Het
Lrch3 A G 16: 32,994,993 T585A probably benign Het
Lrch4 T A 5: 137,639,715 H86Q Het
Map3k20 A G 2: 72,364,718 D113G probably damaging Het
Mbd3l1 T C 9: 18,485,121 S181P probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Med27 A G 2: 29,413,478 R147G possibly damaging Het
Mrps5 T A 2: 127,595,842 S196R possibly damaging Het
Myo16 A T 8: 10,476,185 probably null Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Pcdha11 C T 18: 37,013,192 P779S probably benign Het
Phykpl A G 11: 51,598,703 T379A probably benign Het
Plekha8 A C 6: 54,624,221 M270L probably benign Het
Plekhg5 A G 4: 152,108,428 H593R probably benign Het
Polr2a T C 11: 69,746,370 N293S possibly damaging Het
Prex2 T A 1: 11,162,308 N866K probably benign Het
Psme4 A T 11: 30,807,790 I308L probably benign Het
Ptprb T C 10: 116,341,404 V1003A probably benign Het
Rbbp8 T A 18: 11,732,212 D719E probably damaging Het
Rnaset2b A T 17: 6,991,767 D144V probably benign Het
Senp6 T G 9: 80,126,199 D662E probably damaging Het
Serpinb3c T C 1: 107,273,087 N200S possibly damaging Het
Serpinb9g C G 13: 33,488,560 Y113* probably null Het
Sgf29 T C 7: 126,671,649 I134T probably benign Het
Sh3bp4 T G 1: 89,153,102 probably null Het
Ssfa2 A T 2: 79,636,072 D82V probably damaging Het
Stab1 G A 14: 31,140,826 L2243F probably damaging Het
Sympk T C 7: 19,035,845 V149A probably benign Het
Syt3 C T 7: 44,392,529 Q271* probably null Het
Tas2r109 A G 6: 132,980,700 I89T probably benign Het
Tgif1 A G 17: 70,844,852 S255P probably damaging Het
Tm9sf1 G A 14: 55,637,975 probably benign Het
Tnf A G 17: 35,200,371 F161S possibly damaging Het
Topors A G 4: 40,260,540 S915P unknown Het
Tpm4 C T 8: 72,146,477 L161F probably damaging Het
Trim38 C T 13: 23,791,401 T441I probably damaging Het
Trpv1 A G 11: 73,250,794 M548V probably benign Het
Vmn2r68 T A 7: 85,233,834 T237S probably benign Het
Wdr34 G A 2: 30,038,329 P95L probably benign Het
Zc3hav1 A G 6: 38,332,274 S538P probably benign Het
Zfp541 C T 7: 16,079,369 T649I probably benign Het
Other mutations in Topaz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0083:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0108:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0220:Topaz1 UTSW 9 122749303 missense possibly damaging 0.53
R0519:Topaz1 UTSW 9 122749479 missense possibly damaging 0.53
R0617:Topaz1 UTSW 9 122749906 missense possibly damaging 0.73
R0637:Topaz1 UTSW 9 122791477 nonsense probably null
R0637:Topaz1 UTSW 9 122797662 missense probably benign
R1368:Topaz1 UTSW 9 122748250 missense possibly damaging 0.72
R1519:Topaz1 UTSW 9 122767011 missense probably benign 0.33
R1526:Topaz1 UTSW 9 122796043 missense probably damaging 0.98
R1634:Topaz1 UTSW 9 122780675 splice site probably benign
R1871:Topaz1 UTSW 9 122799479 missense probably benign 0.18
R1879:Topaz1 UTSW 9 122749619 missense possibly damaging 0.70
R1913:Topaz1 UTSW 9 122767013 missense possibly damaging 0.73
R1977:Topaz1 UTSW 9 122747362 missense unknown
R1989:Topaz1 UTSW 9 122750125 missense possibly damaging 0.86
R2237:Topaz1 UTSW 9 122771147 missense probably benign
R2238:Topaz1 UTSW 9 122771147 missense probably benign
R2239:Topaz1 UTSW 9 122771147 missense probably benign
R3160:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3161:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3162:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3821:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3822:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3944:Topaz1 UTSW 9 122750604 missense possibly damaging 0.73
R4571:Topaz1 UTSW 9 122747436 missense probably benign 0.01
R4580:Topaz1 UTSW 9 122747515 missense probably null 0.00
R5043:Topaz1 UTSW 9 122748404 missense probably benign
R5084:Topaz1 UTSW 9 122748818 missense probably benign 0.04
R5234:Topaz1 UTSW 9 122790193 missense possibly damaging 0.82
R5388:Topaz1 UTSW 9 122774093 missense possibly damaging 0.96
R5471:Topaz1 UTSW 9 122791416 splice site probably null
R5706:Topaz1 UTSW 9 122799485 missense possibly damaging 0.53
R5993:Topaz1 UTSW 9 122749039 missense probably benign 0.00
R6104:Topaz1 UTSW 9 122749866 missense probably benign
R6137:Topaz1 UTSW 9 122797756 missense possibly damaging 0.53
R6186:Topaz1 UTSW 9 122748826 missense probably benign 0.33
R6209:Topaz1 UTSW 9 122750505 missense possibly damaging 0.85
R6543:Topaz1 UTSW 9 122748535 missense possibly damaging 0.53
R6548:Topaz1 UTSW 9 122748354 missense possibly damaging 0.53
R6557:Topaz1 UTSW 9 122748895 missense probably benign 0.02
R6636:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6637:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6859:Topaz1 UTSW 9 122801958 missense probably benign 0.33
R7123:Topaz1 UTSW 9 122748415 missense probably damaging 1.00
R7180:Topaz1 UTSW 9 122797705 missense possibly damaging 0.85
R7743:Topaz1 UTSW 9 122785136 missense probably benign 0.16
R7810:Topaz1 UTSW 9 122749185 missense probably benign 0.18
R7871:Topaz1 UTSW 9 122780700 missense possibly damaging 0.96
R7875:Topaz1 UTSW 9 122749587 missense possibly damaging 0.53
R7916:Topaz1 UTSW 9 122747434 missense probably benign 0.05
R8116:Topaz1 UTSW 9 122775643 missense probably benign 0.00
R8437:Topaz1 UTSW 9 122781362 nonsense probably null
X0020:Topaz1 UTSW 9 122774069 missense possibly damaging 0.96
Z1176:Topaz1 UTSW 9 122791494 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCCAGGGCAAGCTAGTTCTC -3'
(R):5'- GACTTCTGAAGCAAAGGAAAGATCC -3'

Sequencing Primer
(F):5'- AGGGCAAGCTAGTTCTCATTCATTC -3'
(R):5'- GGAAAGATCCCCCTCACTGGAG -3'
Posted On2019-06-26