Mutagenetix > Incidental Mutation

Incidental Mutation 'R7319:Psme4'

568072

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

045415-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7319 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30807790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 308 (I308L)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: I308L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: I308L

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154757

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	G	A	5: 90,571,766		probably null	Het
9930012K11Rik	A	T	14: 70,156,186	I287N	probably benign	Het
Aco2	G	T	15: 81,903,619	E223D	probably damaging	Het
Acsf3	T	A	8: 122,813,031	I466N	probably damaging	Het
Aox3	T	A	1: 58,152,602	F438I	probably benign	Het
Arhgap33	T	C	7: 30,526,369	T591A	probably benign	Het
Ash1l	C	T	3: 88,981,387	A191V	probably benign	Het
Btg2	T	C	1: 134,079,041	K5E	probably benign	Het
C1galt1	T	A	6: 7,871,150	Y329N	probably damaging	Het
C87499	G	A	4: 88,629,947	P74S	probably benign	Het
Cacna1h	A	G	17: 25,389,461	I824T	possibly damaging	Het
Carmil3	A	G	14: 55,494,360	I182V	probably benign	Het
Ccdc150	T	A	1: 54,263,337		probably null	Het
Chek1	T	A	9: 36,722,643	R129W	probably damaging	Het
Chrna6	A	G	8: 27,406,787	M354T	possibly damaging	Het
Cpq	A	G	15: 33,250,039	T181A	probably benign	Het
Csmd2	A	T	4: 128,393,679	Y1069F		Het
Defb28	T	A	2: 152,520,054	C45S	possibly damaging	Het
Dnah1	A	G	14: 31,296,594	Y1360H	probably benign	Het
Dnah7c	T	A	1: 46,780,775	D3728E	probably benign	Het
Dnah7c	T	C	1: 46,784,448	V3749A	possibly damaging	Het
Dym	G	A	18: 75,063,174		probably null	Het
Dzip3	A	G	16: 48,927,540		probably null	Het
Eef1akmt4	A	G	16: 20,617,916	K163E	probably benign	Het
Fbrs	A	G	7: 127,482,813	T242A	possibly damaging	Het
Fgfr3	G	A	5: 33,727,802	V87M	possibly damaging	Het
Fst	A	T	13: 114,458,532	C19S	probably benign	Het
Gm7276	G	A	18: 77,185,520	R173W	unknown	Het
Gm9195	G	A	14: 72,460,489	H1284Y	probably benign	Het
Gm9573	GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG	GGGGTGGG	17: 35,622,043		probably benign	Het
Herc6	C	A	6: 57,604,089	T258K	probably damaging	Het
Hip1r	A	G	5: 123,999,111	Y678C	probably damaging	Het
Ifne	A	T	4: 88,880,006	N58K	probably damaging	Het
Ighv1-26	A	T	12: 114,788,543	H60Q	possibly damaging	Het
Ints1	A	G	5: 139,760,765	F1276L	probably damaging	Het
Kcnc4	T	A	3: 107,458,784	E36V	probably benign	Het
Kcnq2	C	T	2: 181,109,102	G315S	probably damaging	Het
Kdm4c	G	A	4: 74,336,963	V585M	probably damaging	Het
Klhl26	C	T	8: 70,452,942	R106H	probably damaging	Het
Kmo	T	C	1: 175,653,655	F313S	probably damaging	Het
Lmtk3	T	A	7: 45,794,316	S808T	unknown	Het
Lrch3	A	G	16: 32,994,993	T585A	probably benign	Het
Lrch4	T	A	5: 137,639,715	H86Q		Het
Map3k20	A	G	2: 72,364,718	D113G	probably damaging	Het
Mbd3l1	T	C	9: 18,485,121	S181P	probably benign	Het
Mccc2	T	C	13: 99,967,733	T303A	probably benign	Het
Med27	A	G	2: 29,413,478	R147G	possibly damaging	Het
Mrps5	T	A	2: 127,595,842	S196R	possibly damaging	Het
Myo16	A	T	8: 10,476,185		probably null	Het
Nudt2	A	T	4: 41,477,575	M19L	probably benign	Het
Pcdha11	C	T	18: 37,013,192	P779S	probably benign	Het
Phykpl	A	G	11: 51,598,703	T379A	probably benign	Het
Plekha8	A	C	6: 54,624,221	M270L	probably benign	Het
Plekhg5	A	G	4: 152,108,428	H593R	probably benign	Het
Polr2a	T	C	11: 69,746,370	N293S	possibly damaging	Het
Prex2	T	A	1: 11,162,308	N866K	probably benign	Het
Ptprb	T	C	10: 116,341,404	V1003A	probably benign	Het
Rbbp8	T	A	18: 11,732,212	D719E	probably damaging	Het
Rnaset2b	A	T	17: 6,991,767	D144V	probably benign	Het
Senp6	T	G	9: 80,126,199	D662E	probably damaging	Het
Serpinb3c	T	C	1: 107,273,087	N200S	possibly damaging	Het
Serpinb9g	C	G	13: 33,488,560	Y113*	probably null	Het
Sgf29	T	C	7: 126,671,649	I134T	probably benign	Het
Sh3bp4	T	G	1: 89,153,102		probably null	Het
Ssfa2	A	T	2: 79,636,072	D82V	probably damaging	Het
Stab1	G	A	14: 31,140,826	L2243F	probably damaging	Het
Sympk	T	C	7: 19,035,845	V149A	probably benign	Het
Syt3	C	T	7: 44,392,529	Q271*	probably null	Het
Tas2r109	A	G	6: 132,980,700	I89T	probably benign	Het
Tgif1	A	G	17: 70,844,852	S255P	probably damaging	Het
Tm9sf1	G	A	14: 55,637,975		probably benign	Het
Tnf	A	G	17: 35,200,371	F161S	possibly damaging	Het
Topaz1	T	A	9: 122,750,363	S779R	possibly damaging	Het
Topors	A	G	4: 40,260,540	S915P	unknown	Het
Tpm4	C	T	8: 72,146,477	L161F	probably damaging	Het
Trim38	C	T	13: 23,791,401	T441I	probably damaging	Het
Trpv1	A	G	11: 73,250,794	M548V	probably benign	Het
Vmn2r68	T	A	7: 85,233,834	T237S	probably benign	Het
Wdr34	G	A	2: 30,038,329	P95L	probably benign	Het
Zc3hav1	A	G	6: 38,332,274	S538P	probably benign	Het
Zfp541	C	T	7: 16,079,369	T649I	probably benign	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTATACCTAACATTCACTTGGC -3'
(R):5'- TCACACAAGGTCCTAGCTCC -3'

Sequencing Primer
(F):5'- CCTAACATTCACTTGGCTATTTAAGG -3'
(R):5'- GGTCCTAGCTCCAACCCC -3'

Posted On

2019-06-26