Incidental Mutation 'R7319:Fst'
ID 568080
Institutional Source Beutler Lab
Gene Symbol Fst
Ensembl Gene ENSMUSG00000021765
Gene Name follistatin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock # R7319 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 114452290-114458951 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114458532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 19 (C19S)
Ref Sequence ENSEMBL: ENSMUSP00000022287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022287] [ENSMUST00000223640] [ENSMUST00000231252]
AlphaFold P47931
Predicted Effect probably benign
Transcript: ENSMUST00000022287
AA Change: C19S

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022287
Gene: ENSMUSG00000021765
AA Change: C19S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FOLN 94 117 2.44e-8 SMART
KAZAL 117 164 9.1e-17 SMART
FOLN 167 190 6.45e-8 SMART
KAZAL 191 239 3.73e-13 SMART
FOLN 243 267 2.09e-7 SMART
KAZAL 265 315 3.03e-13 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223640
AA Change: C19S

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000225068
Predicted Effect probably benign
Transcript: ENSMUST00000231252
AA Change: C19S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice show retarded growth, reduced diaphragm and intercostal muscle mass that lead to neonatal respiratory failure, shiny tight skin, defects of the hard palate and thirteenth ribs, and abnormal whiskers and teeth. Some conditional mutations produce female reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G A 5: 90,571,766 probably null Het
9930012K11Rik A T 14: 70,156,186 I287N probably benign Het
Aco2 G T 15: 81,903,619 E223D probably damaging Het
Acsf3 T A 8: 122,813,031 I466N probably damaging Het
Aox3 T A 1: 58,152,602 F438I probably benign Het
Arhgap33 T C 7: 30,526,369 T591A probably benign Het
Ash1l C T 3: 88,981,387 A191V probably benign Het
Btg2 T C 1: 134,079,041 K5E probably benign Het
C1galt1 T A 6: 7,871,150 Y329N probably damaging Het
C87499 G A 4: 88,629,947 P74S probably benign Het
Cacna1h A G 17: 25,389,461 I824T possibly damaging Het
Carmil3 A G 14: 55,494,360 I182V probably benign Het
Ccdc150 T A 1: 54,263,337 probably null Het
Chek1 T A 9: 36,722,643 R129W probably damaging Het
Chrna6 A G 8: 27,406,787 M354T possibly damaging Het
Cpq A G 15: 33,250,039 T181A probably benign Het
Csmd2 A T 4: 128,393,679 Y1069F Het
Defb28 T A 2: 152,520,054 C45S possibly damaging Het
Dnah1 A G 14: 31,296,594 Y1360H probably benign Het
Dnah7c T A 1: 46,780,775 D3728E probably benign Het
Dnah7c T C 1: 46,784,448 V3749A possibly damaging Het
Dym G A 18: 75,063,174 probably null Het
Dzip3 A G 16: 48,927,540 probably null Het
Eef1akmt4 A G 16: 20,617,916 K163E probably benign Het
Fbrs A G 7: 127,482,813 T242A possibly damaging Het
Fgfr3 G A 5: 33,727,802 V87M possibly damaging Het
Gm7276 G A 18: 77,185,520 R173W unknown Het
Gm9195 G A 14: 72,460,489 H1284Y probably benign Het
Gm9573 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,622,043 probably benign Het
Herc6 C A 6: 57,604,089 T258K probably damaging Het
Hip1r A G 5: 123,999,111 Y678C probably damaging Het
Ifne A T 4: 88,880,006 N58K probably damaging Het
Ighv1-26 A T 12: 114,788,543 H60Q possibly damaging Het
Ints1 A G 5: 139,760,765 F1276L probably damaging Het
Kcnc4 T A 3: 107,458,784 E36V probably benign Het
Kcnq2 C T 2: 181,109,102 G315S probably damaging Het
Kdm4c G A 4: 74,336,963 V585M probably damaging Het
Klhl26 C T 8: 70,452,942 R106H probably damaging Het
Kmo T C 1: 175,653,655 F313S probably damaging Het
Lmtk3 T A 7: 45,794,316 S808T unknown Het
Lrch3 A G 16: 32,994,993 T585A probably benign Het
Lrch4 T A 5: 137,639,715 H86Q Het
Map3k20 A G 2: 72,364,718 D113G probably damaging Het
Mbd3l1 T C 9: 18,485,121 S181P probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Med27 A G 2: 29,413,478 R147G possibly damaging Het
Mrps5 T A 2: 127,595,842 S196R possibly damaging Het
Myo16 A T 8: 10,476,185 probably null Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Pcdha11 C T 18: 37,013,192 P779S probably benign Het
Phykpl A G 11: 51,598,703 T379A probably benign Het
Plekha8 A C 6: 54,624,221 M270L probably benign Het
Plekhg5 A G 4: 152,108,428 H593R probably benign Het
Polr2a T C 11: 69,746,370 N293S possibly damaging Het
Prex2 T A 1: 11,162,308 N866K probably benign Het
Psme4 A T 11: 30,807,790 I308L probably benign Het
Ptprb T C 10: 116,341,404 V1003A probably benign Het
Rbbp8 T A 18: 11,732,212 D719E probably damaging Het
Rnaset2b A T 17: 6,991,767 D144V probably benign Het
Senp6 T G 9: 80,126,199 D662E probably damaging Het
Serpinb3c T C 1: 107,273,087 N200S possibly damaging Het
Serpinb9g C G 13: 33,488,560 Y113* probably null Het
Sgf29 T C 7: 126,671,649 I134T probably benign Het
Sh3bp4 T G 1: 89,153,102 probably null Het
Ssfa2 A T 2: 79,636,072 D82V probably damaging Het
Stab1 G A 14: 31,140,826 L2243F probably damaging Het
Sympk T C 7: 19,035,845 V149A probably benign Het
Syt3 C T 7: 44,392,529 Q271* probably null Het
Tas2r109 A G 6: 132,980,700 I89T probably benign Het
Tgif1 A G 17: 70,844,852 S255P probably damaging Het
Tm9sf1 G A 14: 55,637,975 probably benign Het
Tnf A G 17: 35,200,371 F161S possibly damaging Het
Topaz1 T A 9: 122,750,363 S779R possibly damaging Het
Topors A G 4: 40,260,540 S915P unknown Het
Tpm4 C T 8: 72,146,477 L161F probably damaging Het
Trim38 C T 13: 23,791,401 T441I probably damaging Het
Trpv1 A G 11: 73,250,794 M548V probably benign Het
Vmn2r68 T A 7: 85,233,834 T237S probably benign Het
Wdr34 G A 2: 30,038,329 P95L probably benign Het
Zc3hav1 A G 6: 38,332,274 S538P probably benign Het
Zfp541 C T 7: 16,079,369 T649I probably benign Het
Other mutations in Fst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Fst APN 13 114454360 missense probably damaging 1.00
IGL02213:Fst APN 13 114455854 missense possibly damaging 0.51
R0631:Fst UTSW 13 114454502 missense possibly damaging 0.91
R1391:Fst UTSW 13 114454279 critical splice donor site probably benign
R4884:Fst UTSW 13 114454384 missense probably damaging 1.00
R5326:Fst UTSW 13 114455705 missense probably damaging 1.00
R5542:Fst UTSW 13 114455705 missense probably damaging 1.00
R6700:Fst UTSW 13 114458507 missense probably benign 0.00
R8281:Fst UTSW 13 114455241 missense probably benign 0.02
R8830:Fst UTSW 13 114455828 missense probably damaging 1.00
R8910:Fst UTSW 13 114453709 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATCCTAAAGTGTCACTGCCTTCAG -3'
(R):5'- TCTGACGTCCATTGAATCGC -3'

Sequencing Primer
(F):5'- AGTCTTTCCCTCCCGTTCCG -3'
(R):5'- TCCATTGAATCGCGCGGG -3'
Posted On 2019-06-26