Incidental Mutation 'R7319:Pcdha11'
ID568097
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Nameprotocadherin alpha 11
SynonymsA830022B16Rik, Crnr7, Cnr7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7319 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37010712-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37013192 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 779 (P779S)
Ref Sequence ENSEMBL: ENSMUSP00000111321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115657
AA Change: P779S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206
AA Change: P779S

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192447
AA Change: P779S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206
AA Change: P779S

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G A 5: 90,571,766 probably null Het
9930012K11Rik A T 14: 70,156,186 I287N probably benign Het
Aco2 G T 15: 81,903,619 E223D probably damaging Het
Acsf3 T A 8: 122,813,031 I466N probably damaging Het
Aox3 T A 1: 58,152,602 F438I probably benign Het
Arhgap33 T C 7: 30,526,369 T591A probably benign Het
Ash1l C T 3: 88,981,387 A191V probably benign Het
Btg2 T C 1: 134,079,041 K5E probably benign Het
C1galt1 T A 6: 7,871,150 Y329N probably damaging Het
C87499 G A 4: 88,629,947 P74S probably benign Het
Cacna1h A G 17: 25,389,461 I824T possibly damaging Het
Carmil3 A G 14: 55,494,360 I182V probably benign Het
Ccdc150 T A 1: 54,263,337 probably null Het
Chek1 T A 9: 36,722,643 R129W probably damaging Het
Chrna6 A G 8: 27,406,787 M354T possibly damaging Het
Cpq A G 15: 33,250,039 T181A probably benign Het
Csmd2 A T 4: 128,393,679 Y1069F Het
Defb28 T A 2: 152,520,054 C45S possibly damaging Het
Dnah1 A G 14: 31,296,594 Y1360H probably benign Het
Dnah7c T A 1: 46,780,775 D3728E probably benign Het
Dnah7c T C 1: 46,784,448 V3749A possibly damaging Het
Dym G A 18: 75,063,174 probably null Het
Dzip3 A G 16: 48,927,540 probably null Het
Eef1akmt4 A G 16: 20,617,916 K163E probably benign Het
Fbrs A G 7: 127,482,813 T242A possibly damaging Het
Fgfr3 G A 5: 33,727,802 V87M possibly damaging Het
Fst A T 13: 114,458,532 C19S probably benign Het
Gm7276 G A 18: 77,185,520 R173W unknown Het
Gm9195 G A 14: 72,460,489 H1284Y probably benign Het
Gm9573 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,622,043 probably benign Het
Herc6 C A 6: 57,604,089 T258K probably damaging Het
Hip1r A G 5: 123,999,111 Y678C probably damaging Het
Ifne A T 4: 88,880,006 N58K probably damaging Het
Ighv1-26 A T 12: 114,788,543 H60Q possibly damaging Het
Ints1 A G 5: 139,760,765 F1276L probably damaging Het
Kcnc4 T A 3: 107,458,784 E36V probably benign Het
Kcnq2 C T 2: 181,109,102 G315S probably damaging Het
Kdm4c G A 4: 74,336,963 V585M probably damaging Het
Klhl26 C T 8: 70,452,942 R106H probably damaging Het
Kmo T C 1: 175,653,655 F313S probably damaging Het
Lmtk3 T A 7: 45,794,316 S808T unknown Het
Lrch3 A G 16: 32,994,993 T585A probably benign Het
Lrch4 T A 5: 137,639,715 H86Q Het
Map3k20 A G 2: 72,364,718 D113G probably damaging Het
Mbd3l1 T C 9: 18,485,121 S181P probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Med27 A G 2: 29,413,478 R147G possibly damaging Het
Mrps5 T A 2: 127,595,842 S196R possibly damaging Het
Myo16 A T 8: 10,476,185 probably null Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Phykpl A G 11: 51,598,703 T379A probably benign Het
Plekha8 A C 6: 54,624,221 M270L probably benign Het
Plekhg5 A G 4: 152,108,428 H593R probably benign Het
Polr2a T C 11: 69,746,370 N293S possibly damaging Het
Prex2 T A 1: 11,162,308 N866K probably benign Het
Psme4 A T 11: 30,807,790 I308L probably benign Het
Ptprb T C 10: 116,341,404 V1003A probably benign Het
Rbbp8 T A 18: 11,732,212 D719E probably damaging Het
Rnaset2b A T 17: 6,991,767 D144V probably benign Het
Senp6 T G 9: 80,126,199 D662E probably damaging Het
Serpinb3c T C 1: 107,273,087 N200S possibly damaging Het
Serpinb9g C G 13: 33,488,560 Y113* probably null Het
Sgf29 T C 7: 126,671,649 I134T probably benign Het
Sh3bp4 T G 1: 89,153,102 probably null Het
Ssfa2 A T 2: 79,636,072 D82V probably damaging Het
Stab1 G A 14: 31,140,826 L2243F probably damaging Het
Sympk T C 7: 19,035,845 V149A probably benign Het
Syt3 C T 7: 44,392,529 Q271* probably null Het
Tas2r109 A G 6: 132,980,700 I89T probably benign Het
Tgif1 A G 17: 70,844,852 S255P probably damaging Het
Tm9sf1 G A 14: 55,637,975 probably benign Het
Tnf A G 17: 35,200,371 F161S possibly damaging Het
Topaz1 T A 9: 122,750,363 S779R possibly damaging Het
Topors A G 4: 40,260,540 S915P unknown Het
Tpm4 C T 8: 72,146,477 L161F probably damaging Het
Trim38 C T 13: 23,791,401 T441I probably damaging Het
Trpv1 A G 11: 73,250,794 M548V probably benign Het
Vmn2r68 T A 7: 85,233,834 T237S probably benign Het
Wdr34 G A 2: 30,038,329 P95L probably benign Het
Zc3hav1 A G 6: 38,332,274 S538P probably benign Het
Zfp541 C T 7: 16,079,369 T649I probably benign Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37007373 missense probably benign 0.13
R4489:Pcdha11 UTSW 18 37006916 missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37012169 splice site probably null
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37011368 nonsense probably null
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7352:Pcdha11 UTSW 18 37006845 missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
R7660:Pcdha11 UTSW 18 37005851 missense probably benign 0.17
R7677:Pcdha11 UTSW 18 37011552 missense probably damaging 1.00
R7707:Pcdha11 UTSW 18 37011792 missense probably benign 0.00
R7775:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7778:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7780:Pcdha11 UTSW 18 37012796 missense probably damaging 0.97
R7916:Pcdha11 UTSW 18 37007388 missense probably benign 0.01
R7991:Pcdha11 UTSW 18 37012856 missense probably damaging 0.99
R8068:Pcdha11 UTSW 18 37005565 missense probably damaging 1.00
R8220:Pcdha11 UTSW 18 37006571 missense probably benign 0.01
R8252:Pcdha11 UTSW 18 37007537 missense possibly damaging 0.65
R8392:Pcdha11 UTSW 18 37006159 nonsense probably null
R8398:Pcdha11 UTSW 18 37013063 missense possibly damaging 0.65
RF017:Pcdha11 UTSW 18 37005524 missense possibly damaging 0.92
Z1177:Pcdha11 UTSW 18 37012923 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCCAGCCTGTTGGTACTCAC -3'
(R):5'- CTAACGGTCGTTGTTCCTTGAAAC -3'

Sequencing Primer
(F):5'- ACGCTGCTGCTGTATACAG -3'
(R):5'- GTCGTTGTTCCTTGAAACAGCAC -3'
Posted On2019-06-26