Incidental Mutation 'R7319:Pcdha11'
ID568097
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Nameprotocadherin alpha 11
SynonymsA830022B16Rik, Crnr7, Cnr7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7319 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37010712-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37013192 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 779 (P779S)
Ref Sequence ENSEMBL: ENSMUSP00000111321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115657
AA Change: P779S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206
AA Change: P779S

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192447
AA Change: P779S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206
AA Change: P779S

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G A 5: 90,571,766 probably null Het
9930012K11Rik A T 14: 70,156,186 I287N probably benign Het
Aco2 G T 15: 81,903,619 E223D probably damaging Het
Acsf3 T A 8: 122,813,031 I466N probably damaging Het
Aox3 T A 1: 58,152,602 F438I probably benign Het
Arhgap33 T C 7: 30,526,369 T591A probably benign Het
Ash1l C T 3: 88,981,387 A191V probably benign Het
Btg2 T C 1: 134,079,041 K5E probably benign Het
C1galt1 T A 6: 7,871,150 Y329N probably damaging Het
C87499 G A 4: 88,629,947 P74S probably benign Het
Cacna1h A G 17: 25,389,461 I824T possibly damaging Het
Carmil3 A G 14: 55,494,360 I182V probably benign Het
Ccdc150 T A 1: 54,263,337 probably null Het
Chek1 T A 9: 36,722,643 R129W probably damaging Het
Chrna6 A G 8: 27,406,787 M354T possibly damaging Het
Cpq A G 15: 33,250,039 T181A probably benign Het
Csmd2 A T 4: 128,393,679 Y1069F Het
Defb28 T A 2: 152,520,054 C45S possibly damaging Het
Dnah1 A G 14: 31,296,594 Y1360H probably benign Het
Dnah7c T A 1: 46,780,775 D3728E probably benign Het
Dnah7c T C 1: 46,784,448 V3749A possibly damaging Het
Dym G A 18: 75,063,174 probably null Het
Dzip3 A G 16: 48,927,540 probably null Het
Eef1akmt4 A G 16: 20,617,916 K163E probably benign Het
Fbrs A G 7: 127,482,813 T242A possibly damaging Het
Fgfr3 G A 5: 33,727,802 V87M possibly damaging Het
Fst A T 13: 114,458,532 C19S probably benign Het
Gm7276 G A 18: 77,185,520 R173W unknown Het
Gm9195 G A 14: 72,460,489 H1284Y probably benign Het
Gm9573 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,622,043 probably benign Het
Herc6 C A 6: 57,604,089 T258K probably damaging Het
Hip1r A G 5: 123,999,111 Y678C probably damaging Het
Ifne A T 4: 88,880,006 N58K probably damaging Het
Ighv1-26 A T 12: 114,788,543 H60Q possibly damaging Het
Ints1 A G 5: 139,760,765 F1276L probably damaging Het
Kcnc4 T A 3: 107,458,784 E36V probably benign Het
Kcnq2 C T 2: 181,109,102 G315S probably damaging Het
Kdm4c G A 4: 74,336,963 V585M probably damaging Het
Klhl26 C T 8: 70,452,942 R106H probably damaging Het
Kmo T C 1: 175,653,655 F313S probably damaging Het
Lmtk3 T A 7: 45,794,316 S808T unknown Het
Lrch3 A G 16: 32,994,993 T585A probably benign Het
Lrch4 T A 5: 137,639,715 H86Q Het
Map3k20 A G 2: 72,364,718 D113G probably damaging Het
Mbd3l1 T C 9: 18,485,121 S181P probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Med27 A G 2: 29,413,478 R147G possibly damaging Het
Mrps5 T A 2: 127,595,842 S196R possibly damaging Het
Myo16 A T 8: 10,476,185 probably null Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Phykpl A G 11: 51,598,703 T379A probably benign Het
Plekha8 A C 6: 54,624,221 M270L probably benign Het
Plekhg5 A G 4: 152,108,428 H593R probably benign Het
Polr2a T C 11: 69,746,370 N293S possibly damaging Het
Prex2 T A 1: 11,162,308 N866K probably benign Het
Psme4 A T 11: 30,807,790 I308L probably benign Het
Ptprb T C 10: 116,341,404 V1003A probably benign Het
Rbbp8 T A 18: 11,732,212 D719E probably damaging Het
Rnaset2b A T 17: 6,991,767 D144V probably benign Het
Senp6 T G 9: 80,126,199 D662E probably damaging Het
Serpinb3c T C 1: 107,273,087 N200S possibly damaging Het
Serpinb9g C G 13: 33,488,560 Y113* probably null Het
Sgf29 T C 7: 126,671,649 I134T probably benign Het
Sh3bp4 T G 1: 89,153,102 probably null Het
Ssfa2 A T 2: 79,636,072 D82V probably damaging Het
Stab1 G A 14: 31,140,826 L2243F probably damaging Het
Sympk T C 7: 19,035,845 V149A probably benign Het
Syt3 C T 7: 44,392,529 Q271* probably null Het
Tas2r109 A G 6: 132,980,700 I89T probably benign Het
Tgif1 A G 17: 70,844,852 S255P probably damaging Het
Tm9sf1 G A 14: 55,637,975 probably benign Het
Tnf A G 17: 35,200,371 F161S possibly damaging Het
Topaz1 T A 9: 122,750,363 S779R possibly damaging Het
Topors A G 4: 40,260,540 S915P unknown Het
Tpm4 C T 8: 72,146,477 L161F probably damaging Het
Trim38 C T 13: 23,791,401 T441I probably damaging Het
Trpv1 A G 11: 73,250,794 M548V probably benign Het
Vmn2r68 T A 7: 85,233,834 T237S probably benign Het
Wdr34 G A 2: 30,038,329 P95L probably benign Het
Zc3hav1 A G 6: 38,332,274 S538P probably benign Het
Zfp541 C T 7: 16,079,369 T649I probably benign Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37007373 missense probably benign 0.13
R4489:Pcdha11 UTSW 18 37006916 missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37012169 unclassified probably null
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37011368 nonsense probably null
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7352:Pcdha11 UTSW 18 37006845 missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAGCCTGTTGGTACTCAC -3'
(R):5'- CTAACGGTCGTTGTTCCTTGAAAC -3'

Sequencing Primer
(F):5'- ACGCTGCTGCTGTATACAG -3'
(R):5'- GTCGTTGTTCCTTGAAACAGCAC -3'
Posted On2019-06-26