Mutagenetix > Incidental Mutation

Incidental Mutation 'R7320:Vil1'

568101

Institutional Source

Beutler Lab

Gene Symbol

Vil1

Ensembl Gene

ENSMUSG00000026175

Gene Name

villin 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R7320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74409376-74435559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74418444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 79 (A79T)

Ref Sequence

ENSEMBL: ENSMUSP00000027366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027366]

AlphaFold

Q62468

Predicted Effect

probably damaging
Transcript: ENSMUST00000027366
AA Change: A79T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: A79T

Domain	Start	End	E-Value	Type
GEL	17	114	2.93e-29	SMART
GEL	135	229	1.33e-18	SMART
GEL	251	349	5.85e-29	SMART
GEL	398	495	1.44e-28	SMART
GEL	515	601	7.31e-30	SMART
GEL	620	714	1.36e-29	SMART
VHP	792	827	1.77e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159749

SMART Domains

Protein: ENSMUSP00000123786
Gene: ENSMUSG00000026175

Domain	Start	End	E-Value	Type
GEL	37	131	1.33e-18	SMART
GEL	153	248	6.68e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,464,303	K650*	probably null	Het
Abcc3	A	G	11: 94,367,645	I458T	probably benign	Het
Adam29	A	G	8: 55,872,714	I235T	possibly damaging	Het
AF529169	A	G	9: 89,601,626	S573P	probably benign	Het
Afap1	G	A	5: 35,948,223	V174I	probably damaging	Het
Ak8	A	T	2: 28,812,992	D456V	probably damaging	Het
Alb	T	C	5: 90,464,987		probably null	Het
Alox12	C	T	11: 70,254,472	A92T	probably benign	Het
Arhgap23	T	C	11: 97,451,545	S218P	probably benign	Het
Blm	G	A	7: 80,455,354	Q1389*	probably null	Het
C1ql4	A	T	15: 99,087,724	V2E	unknown	Het
Casp12	A	G	9: 5,348,897		probably null	Het
Ccdc73	A	T	2: 104,999,176	I1065F	possibly damaging	Het
Ccdc83	C	T	7: 90,224,034	G371D	probably damaging	Het
Cfap65	A	G	1: 74,926,604	S416P	probably damaging	Het
Cftr	T	A	6: 18,319,013	C1351S	probably damaging	Het
Clcn4	A	T	7: 7,291,828	H311Q	probably benign	Het
Cldn13	T	G	5: 134,915,020	I104L	probably benign	Het
Cul9	A	G	17: 46,510,909	V1880A	possibly damaging	Het
Ddx17	A	T	15: 79,531,904	D407E	probably damaging	Het
Ddx28	G	A	8: 106,011,325	P34S	probably damaging	Het
Dnah5	A	T	15: 28,270,470	N973Y	probably null	Het
Dock10	A	G	1: 80,549,704		probably null	Het
Dock3	T	C	9: 106,895,524	D510G	probably benign	Het
Dst	T	A	1: 34,191,094	D2589E	probably benign	Het
E2f7	T	C	10: 110,764,130	Y249H	not run	Het
Eef2kmt	T	C	16: 5,250,509	Y69C	possibly damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Exog	G	T	9: 119,462,478	V274L	possibly damaging	Het
Fam83e	G	A	7: 45,722,472	V98M	probably benign	Het
Fras1	C	T	5: 96,709,886	T2013I	probably benign	Het
Gart	G	T	16: 91,621,681	A970E	probably benign	Het
Gga2	T	A	7: 122,002,103	H259L	probably benign	Het
Glis3	C	A	19: 28,531,598	V329F	probably damaging	Het
Gm6356	T	A	14: 6,972,923	N53I	probably damaging	Het
Golgb1	C	A	16: 36,915,951	C1894*	probably null	Het
Ifi203	T	C	1: 173,929,167	N350S	unknown	Het
Isy1	T	A	6: 87,833,706	R55S	unknown	Het
Itsn1	A	T	16: 91,839,699	D678V	unknown	Het
Lhcgr	T	A	17: 88,742,078	R673S	probably benign	Het
Lnx2	C	A	5: 147,020,133	R601L	possibly damaging	Het
Map4	A	G	9: 110,081,517	T1093A	probably benign	Het
Mink1	A	G	11: 70,599,073	K92E	probably benign	Het
Moxd1	A	G	10: 24,301,465	I560V	probably benign	Het
Mrc2	C	A	11: 105,329,235	D327E	possibly damaging	Het
Notch2	A	G	3: 98,131,327	E1262G	possibly damaging	Het
Olfr1025-ps1	A	T	2: 85,918,374	I150F	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1298	A	G	2: 111,645,952	L15S	probably benign	Het
Olfr1434	G	A	19: 12,283,816	G256D	possibly damaging	Het
Olfr1477	T	A	19: 13,503,180	M279K	possibly damaging	Het
Olfr653	C	A	7: 104,580,438	S264*	probably null	Het
Olfr785	A	T	10: 129,409,785	T140S	possibly damaging	Het
Pcbp2	T	A	15: 102,473,347	V5E	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pgghg	A	T	7: 140,943,040	Y104F	probably benign	Het
Plscr2	T	C	9: 92,291,140		probably null	Het
Ppfibp1	C	T	6: 146,978,053	A25V	probably damaging	Het
Ptgfr	C	T	3: 151,835,397	G158D	probably benign	Het
Ptgs2	T	C	1: 150,102,695	F186S	probably damaging	Het
Ptpn14	A	G	1: 189,832,759	E181G	probably benign	Het
Rpgrip1	A	G	14: 52,131,216	K291E	possibly damaging	Het
Rtn4rl1	T	C	11: 75,194,296		probably null	Het
Sema3b	T	A	9: 107,600,942	M415L	probably benign	Het
Sh3bp4	A	G	1: 89,145,494	E688G	probably damaging	Het
Slco6c1	G	A	1: 97,128,162	R5C	possibly damaging	Het
Slmap	A	G	14: 26,460,072	F369L	possibly damaging	Het
Sphk2	T	C	7: 45,712,470	N181S	possibly damaging	Het
Sqor	A	G	2: 122,799,810	T235A	probably benign	Het
St13	A	G	15: 81,389,653	L80P	probably damaging	Het
St3gal6	A	G	16: 58,493,711	Y20H	probably benign	Het
Sun1	T	G	5: 139,248,484	Y899D	probably damaging	Het
Synm	C	T	7: 67,735,380	E845K	possibly damaging	Het
Tg	A	T	15: 66,694,784	D1227V	possibly damaging	Het
Thbs1	A	G	2: 118,114,957	N306D	possibly damaging	Het
Tmcc3	A	T	10: 94,578,495	N51Y	possibly damaging	Het
Usp4	A	G	9: 108,388,306	D856G	probably benign	Het
Vmn1r119	T	A	7: 21,012,346	H37L	probably damaging	Het
Vmn2r110	A	T	17: 20,596,054	M69K	probably benign	Het
Wdr78	A	T	4: 103,050,187	I634N	possibly damaging	Het
Ywhaq	A	G	12: 21,394,981	L221P	probably damaging	Het
Zfp142	G	A	1: 74,570,008	Q1543*	probably null	Het
Zfp384	T	A	6: 125,024,830	M146K	possibly damaging	Het

Other mutations in Vil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Vil1	APN	1	74423875	missense	probably damaging	1.00
IGL00703:Vil1	APN	1	74423960	missense	possibly damaging	0.61
IGL01011:Vil1	APN	1	74434887	splice site	probably null
IGL01314:Vil1	APN	1	74428238	missense	probably damaging	1.00
IGL01772:Vil1	APN	1	74415119	missense	probably benign
IGL02378:Vil1	APN	1	74430691	splice site	probably null
IGL02517:Vil1	APN	1	74426692	missense	probably benign	0.43
IGL02955:Vil1	APN	1	74418523	missense	probably benign	0.10
IGL03036:Vil1	APN	1	74419612	missense	probably damaging	1.00
PIT4362001:Vil1	UTSW	1	74421383	missense	probably damaging	1.00
R0104:Vil1	UTSW	1	74418366	missense	probably benign	0.44
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0496:Vil1	UTSW	1	74421340	missense	possibly damaging	0.88
R1329:Vil1	UTSW	1	74427558	missense	probably benign	0.00
R1824:Vil1	UTSW	1	74418447	missense	probably benign	0.00
R1916:Vil1	UTSW	1	74418525	missense	probably benign
R2188:Vil1	UTSW	1	74427565	missense	probably benign	0.22
R2216:Vil1	UTSW	1	74425679	missense	probably benign	0.05
R3808:Vil1	UTSW	1	74427613	missense	probably benign
R3939:Vil1	UTSW	1	74432415	missense	probably benign	0.09
R4288:Vil1	UTSW	1	74418525	missense	probably benign
R4648:Vil1	UTSW	1	74432298	missense	probably benign
R4748:Vil1	UTSW	1	74421266	missense	probably damaging	1.00
R5333:Vil1	UTSW	1	74432390	missense	probably benign
R5429:Vil1	UTSW	1	74432331	missense	probably benign	0.05
R5973:Vil1	UTSW	1	74416033	missense	possibly damaging	0.93
R6007:Vil1	UTSW	1	74419867	missense	probably damaging	1.00
R6247:Vil1	UTSW	1	74432339	missense	probably benign
R6306:Vil1	UTSW	1	74421311	missense	possibly damaging	0.90
R6989:Vil1	UTSW	1	74423954	missense	probably damaging	0.99
R7112:Vil1	UTSW	1	74416002	missense	probably damaging	1.00
R7481:Vil1	UTSW	1	74419899	missense	probably damaging	1.00
R7553:Vil1	UTSW	1	74426732	critical splice donor site	probably null
R7709:Vil1	UTSW	1	74426595	missense	probably benign	0.39
R7791:Vil1	UTSW	1	74428136	missense	probably damaging	1.00
R8159:Vil1	UTSW	1	74423977	missense	probably benign	0.00
R8190:Vil1	UTSW	1	74434893	nonsense	probably null
R9650:Vil1	UTSW	1	74425616	missense	probably benign	0.32
R9679:Vil1	UTSW	1	74430674	missense	probably benign	0.00
R9734:Vil1	UTSW	1	74415150	missense	possibly damaging	0.46
Z1176:Vil1	UTSW	1	74428232	missense	probably damaging	0.98
Z1177:Vil1	UTSW	1	74415132	missense	probably damaging	1.00
Z1177:Vil1	UTSW	1	74421430	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGTGTGTGGCAGATCCGAC -3'
(R):5'- AGAGTCTCTCACACTTCAGGC -3'

Sequencing Primer
(F):5'- TGTGGCAGATCCGACAGAATG -3'
(R):5'- AGTCTCTCACACTTCAGGCCTTAATG -3'

Posted On

2019-06-26