Incidental Mutation 'R7320:Vil1'
ID 568101
Institutional Source Beutler Lab
Gene Symbol Vil1
Ensembl Gene ENSMUSG00000026175
Gene Name villin 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R7320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74409376-74435559 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74418444 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 79 (A79T)
Ref Sequence ENSEMBL: ENSMUSP00000027366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027366]
AlphaFold Q62468
Predicted Effect probably damaging
Transcript: ENSMUST00000027366
AA Change: A79T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: A79T

DomainStartEndE-ValueType
GEL 17 114 2.93e-29 SMART
GEL 135 229 1.33e-18 SMART
GEL 251 349 5.85e-29 SMART
GEL 398 495 1.44e-28 SMART
GEL 515 601 7.31e-30 SMART
GEL 620 714 1.36e-29 SMART
VHP 792 827 1.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159749
SMART Domains Protein: ENSMUSP00000123786
Gene: ENSMUSG00000026175

DomainStartEndE-ValueType
GEL 37 131 1.33e-18 SMART
GEL 153 248 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)          

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Vil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Vil1 APN 1 74423875 missense probably damaging 1.00
IGL00703:Vil1 APN 1 74423960 missense possibly damaging 0.61
IGL01011:Vil1 APN 1 74434887 splice site probably null
IGL01314:Vil1 APN 1 74428238 missense probably damaging 1.00
IGL01772:Vil1 APN 1 74415119 missense probably benign
IGL02378:Vil1 APN 1 74430691 splice site probably null
IGL02517:Vil1 APN 1 74426692 missense probably benign 0.43
IGL02955:Vil1 APN 1 74418523 missense probably benign 0.10
IGL03036:Vil1 APN 1 74419612 missense probably damaging 1.00
PIT4362001:Vil1 UTSW 1 74421383 missense probably damaging 1.00
R0104:Vil1 UTSW 1 74418366 missense probably benign 0.44
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0496:Vil1 UTSW 1 74421340 missense possibly damaging 0.88
R1329:Vil1 UTSW 1 74427558 missense probably benign 0.00
R1824:Vil1 UTSW 1 74418447 missense probably benign 0.00
R1916:Vil1 UTSW 1 74418525 missense probably benign
R2188:Vil1 UTSW 1 74427565 missense probably benign 0.22
R2216:Vil1 UTSW 1 74425679 missense probably benign 0.05
R3808:Vil1 UTSW 1 74427613 missense probably benign
R3939:Vil1 UTSW 1 74432415 missense probably benign 0.09
R4288:Vil1 UTSW 1 74418525 missense probably benign
R4648:Vil1 UTSW 1 74432298 missense probably benign
R4748:Vil1 UTSW 1 74421266 missense probably damaging 1.00
R5333:Vil1 UTSW 1 74432390 missense probably benign
R5429:Vil1 UTSW 1 74432331 missense probably benign 0.05
R5973:Vil1 UTSW 1 74416033 missense possibly damaging 0.93
R6007:Vil1 UTSW 1 74419867 missense probably damaging 1.00
R6247:Vil1 UTSW 1 74432339 missense probably benign
R6306:Vil1 UTSW 1 74421311 missense possibly damaging 0.90
R6989:Vil1 UTSW 1 74423954 missense probably damaging 0.99
R7112:Vil1 UTSW 1 74416002 missense probably damaging 1.00
R7481:Vil1 UTSW 1 74419899 missense probably damaging 1.00
R7553:Vil1 UTSW 1 74426732 critical splice donor site probably null
R7709:Vil1 UTSW 1 74426595 missense probably benign 0.39
R7791:Vil1 UTSW 1 74428136 missense probably damaging 1.00
R8159:Vil1 UTSW 1 74423977 missense probably benign 0.00
R8190:Vil1 UTSW 1 74434893 nonsense probably null
R9650:Vil1 UTSW 1 74425616 missense probably benign 0.32
R9679:Vil1 UTSW 1 74430674 missense probably benign 0.00
R9734:Vil1 UTSW 1 74415150 missense possibly damaging 0.46
Z1176:Vil1 UTSW 1 74428232 missense probably damaging 0.98
Z1177:Vil1 UTSW 1 74415132 missense probably damaging 1.00
Z1177:Vil1 UTSW 1 74421430 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGTGTGGCAGATCCGAC -3'
(R):5'- AGAGTCTCTCACACTTCAGGC -3'

Sequencing Primer
(F):5'- TGTGGCAGATCCGACAGAATG -3'
(R):5'- AGTCTCTCACACTTCAGGCCTTAATG -3'
Posted On 2019-06-26