Mutagenetix > Incidental Mutation

Incidental Mutation 'R7320:Cfap65'

568103

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

045370-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R7320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74926604 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 416 (S416P)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: S416P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: S416P

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,464,303	K650*	probably null	Het
Abcc3	A	G	11: 94,367,645	I458T	probably benign	Het
Adam29	A	G	8: 55,872,714	I235T	possibly damaging	Het
AF529169	A	G	9: 89,601,626	S573P	probably benign	Het
Afap1	G	A	5: 35,948,223	V174I	probably damaging	Het
Ak8	A	T	2: 28,812,992	D456V	probably damaging	Het
Alb	T	C	5: 90,464,987		probably null	Het
Alox12	C	T	11: 70,254,472	A92T	probably benign	Het
Arhgap23	T	C	11: 97,451,545	S218P	probably benign	Het
Blm	G	A	7: 80,455,354	Q1389*	probably null	Het
C1ql4	A	T	15: 99,087,724	V2E	unknown	Het
Casp12	A	G	9: 5,348,897		probably null	Het
Ccdc73	A	T	2: 104,999,176	I1065F	possibly damaging	Het
Ccdc83	C	T	7: 90,224,034	G371D	probably damaging	Het
Cftr	T	A	6: 18,319,013	C1351S	probably damaging	Het
Clcn4	A	T	7: 7,291,828	H311Q	probably benign	Het
Cldn13	T	G	5: 134,915,020	I104L	probably benign	Het
Cul9	A	G	17: 46,510,909	V1880A	possibly damaging	Het
Ddx17	A	T	15: 79,531,904	D407E	probably damaging	Het
Ddx28	G	A	8: 106,011,325	P34S	probably damaging	Het
Dnah5	A	T	15: 28,270,470	N973Y	probably null	Het
Dock10	A	G	1: 80,549,704		probably null	Het
Dock3	T	C	9: 106,895,524	D510G	probably benign	Het
Dst	T	A	1: 34,191,094	D2589E	probably benign	Het
E2f7	T	C	10: 110,764,130	Y249H	not run	Het
Eef2kmt	T	C	16: 5,250,509	Y69C	possibly damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Exog	G	T	9: 119,462,478	V274L	possibly damaging	Het
Fam83e	G	A	7: 45,722,472	V98M	probably benign	Het
Fras1	C	T	5: 96,709,886	T2013I	probably benign	Het
Gart	G	T	16: 91,621,681	A970E	probably benign	Het
Gga2	T	A	7: 122,002,103	H259L	probably benign	Het
Glis3	C	A	19: 28,531,598	V329F	probably damaging	Het
Gm6356	T	A	14: 6,972,923	N53I	probably damaging	Het
Golgb1	C	A	16: 36,915,951	C1894*	probably null	Het
Ifi203	T	C	1: 173,929,167	N350S	unknown	Het
Isy1	T	A	6: 87,833,706	R55S	unknown	Het
Itsn1	A	T	16: 91,839,699	D678V	unknown	Het
Lhcgr	T	A	17: 88,742,078	R673S	probably benign	Het
Lnx2	C	A	5: 147,020,133	R601L	possibly damaging	Het
Map4	A	G	9: 110,081,517	T1093A	probably benign	Het
Mink1	A	G	11: 70,599,073	K92E	probably benign	Het
Moxd1	A	G	10: 24,301,465	I560V	probably benign	Het
Mrc2	C	A	11: 105,329,235	D327E	possibly damaging	Het
Notch2	A	G	3: 98,131,327	E1262G	possibly damaging	Het
Olfr1025-ps1	A	T	2: 85,918,374	I150F	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1298	A	G	2: 111,645,952	L15S	probably benign	Het
Olfr1434	G	A	19: 12,283,816	G256D	possibly damaging	Het
Olfr1477	T	A	19: 13,503,180	M279K	possibly damaging	Het
Olfr653	C	A	7: 104,580,438	S264*	probably null	Het
Olfr785	A	T	10: 129,409,785	T140S	possibly damaging	Het
Pcbp2	T	A	15: 102,473,347	V5E	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pgghg	A	T	7: 140,943,040	Y104F	probably benign	Het
Plscr2	T	C	9: 92,291,140		probably null	Het
Ppfibp1	C	T	6: 146,978,053	A25V	probably damaging	Het
Ptgfr	C	T	3: 151,835,397	G158D	probably benign	Het
Ptgs2	T	C	1: 150,102,695	F186S	probably damaging	Het
Ptpn14	A	G	1: 189,832,759	E181G	probably benign	Het
Rpgrip1	A	G	14: 52,131,216	K291E	possibly damaging	Het
Rtn4rl1	T	C	11: 75,194,296		probably null	Het
Sema3b	T	A	9: 107,600,942	M415L	probably benign	Het
Sh3bp4	A	G	1: 89,145,494	E688G	probably damaging	Het
Slco6c1	G	A	1: 97,128,162	R5C	possibly damaging	Het
Slmap	A	G	14: 26,460,072	F369L	possibly damaging	Het
Sphk2	T	C	7: 45,712,470	N181S	possibly damaging	Het
Sqor	A	G	2: 122,799,810	T235A	probably benign	Het
St13	A	G	15: 81,389,653	L80P	probably damaging	Het
St3gal6	A	G	16: 58,493,711	Y20H	probably benign	Het
Sun1	T	G	5: 139,248,484	Y899D	probably damaging	Het
Synm	C	T	7: 67,735,380	E845K	possibly damaging	Het
Tg	A	T	15: 66,694,784	D1227V	possibly damaging	Het
Thbs1	A	G	2: 118,114,957	N306D	possibly damaging	Het
Tmcc3	A	T	10: 94,578,495	N51Y	possibly damaging	Het
Usp4	A	G	9: 108,388,306	D856G	probably benign	Het
Vil1	G	A	1: 74,418,444	A79T	probably damaging	Het
Vmn1r119	T	A	7: 21,012,346	H37L	probably damaging	Het
Vmn2r110	A	T	17: 20,596,054	M69K	probably benign	Het
Wdr78	A	T	4: 103,050,187	I634N	possibly damaging	Het
Ywhaq	A	G	12: 21,394,981	L221P	probably damaging	Het
Zfp142	G	A	1: 74,570,008	Q1543*	probably null	Het
Zfp384	T	A	6: 125,024,830	M146K	possibly damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATCTCCTAGTCTCAGGGC -3'
(R):5'- ATATCTTTTGAGGCTGGCACC -3'

Sequencing Primer
(F):5'- CATCACTCACCTGGTGATGGATGAG -3'
(R):5'- GGCACCCTCCAGCCCAC -3'

Posted On

2019-06-26