Incidental Mutation 'R7320:Olfr1298'
ID 568115
Institutional Source Beutler Lab
Gene Symbol Olfr1298
Ensembl Gene ENSMUSG00000109487
Gene Name olfactory receptor 1298
Synonyms GA_x6K02T2Q125-72697413-72696475, MOR248-6
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R7320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111644498-111649201 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111645952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 15 (L15S)
Ref Sequence ENSEMBL: ENSMUSP00000146343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119566] [ENSMUST00000208284]
AlphaFold Q8VGE6
Predicted Effect probably benign
Transcript: ENSMUST00000119566
AA Change: L15S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000208284
AA Change: L15S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Olfr1298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Olfr1298 APN 2 111645256 missense probably damaging 1.00
IGL01571:Olfr1298 APN 2 111645380 missense probably benign 0.00
IGL02605:Olfr1298 APN 2 111645505 missense probably benign 0.00
IGL02652:Olfr1298 APN 2 111645494 missense probably benign 0.16
IGL02669:Olfr1298 APN 2 111645891 nonsense probably null
R0197:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R0701:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R0883:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R1563:Olfr1298 UTSW 2 111645682 missense probably damaging 1.00
R1567:Olfr1298 UTSW 2 111645926 missense possibly damaging 0.92
R1740:Olfr1298 UTSW 2 111645869 missense probably damaging 0.97
R2142:Olfr1298 UTSW 2 111645221 missense probably benign 0.04
R3949:Olfr1298 UTSW 2 111645526 missense possibly damaging 0.67
R4766:Olfr1298 UTSW 2 111645881 missense probably benign
R4924:Olfr1298 UTSW 2 111645776 missense possibly damaging 0.87
R7695:Olfr1298 UTSW 2 111645625 missense probably damaging 1.00
R7961:Olfr1298 UTSW 2 111645937 missense probably damaging 0.97
R8549:Olfr1298 UTSW 2 111649167 start gained probably benign
R8958:Olfr1298 UTSW 2 111645725 missense possibly damaging 0.93
R9444:Olfr1298 UTSW 2 111645787 missense probably damaging 1.00
R9744:Olfr1298 UTSW 2 111645319 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAAATGGTCTTGTTTTCGC -3'
(R):5'- CAGGTGAGTTCTAATATGGATGCC -3'

Sequencing Primer
(F):5'- TTTGAGGAGAGCCACATGTC -3'
(R):5'- TGGATGCCTAATTTTACAAACGAAG -3'
Posted On 2019-06-26