Mutagenetix > Incidental Mutation

Incidental Mutation 'R7320:Sqor'

568117

Institutional Source

Beutler Lab

Gene Symbol

Sqor

Ensembl Gene

ENSMUSG00000005803

Gene Name

sulfide quinone oxidoreductase

Synonyms

0610039J17Rik, Sqrdl, flavo-binding protein, 4930557M22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122765237-122809569 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122799810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 235 (T235A)

Ref Sequence

ENSEMBL: ENSMUSP00000005953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005953] [ENSMUST00000110506] [ENSMUST00000126403] [ENSMUST00000176343]

AlphaFold

Q9R112

Predicted Effect

probably benign
Transcript: ENSMUST00000005953
AA Change: T235A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000005953
Gene: ENSMUSG00000005803
AA Change: T235A

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	44	189	1.7e-11	PFAM
SCOP:d1fcda1	240	364	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110506
AA Change: T235A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106133
Gene: ENSMUSG00000005803
AA Change: T235A

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	45	342	7e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126403
AA Change: T235A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117575
Gene: ENSMUSG00000005803
AA Change: T235A

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	45	192	8.3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176343
AA Change: T17A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135786
Gene: ENSMUSG00000005803
AA Change: T17A

Domain	Start	End	E-Value	Type
SCOP:d1fl2a1	25	132	6e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,464,303	K650*	probably null	Het
Abcc3	A	G	11: 94,367,645	I458T	probably benign	Het
Adam29	A	G	8: 55,872,714	I235T	possibly damaging	Het
AF529169	A	G	9: 89,601,626	S573P	probably benign	Het
Afap1	G	A	5: 35,948,223	V174I	probably damaging	Het
Ak8	A	T	2: 28,812,992	D456V	probably damaging	Het
Alb	T	C	5: 90,464,987		probably null	Het
Alox12	C	T	11: 70,254,472	A92T	probably benign	Het
Arhgap23	T	C	11: 97,451,545	S218P	probably benign	Het
Blm	G	A	7: 80,455,354	Q1389*	probably null	Het
C1ql4	A	T	15: 99,087,724	V2E	unknown	Het
Casp12	A	G	9: 5,348,897		probably null	Het
Ccdc73	A	T	2: 104,999,176	I1065F	possibly damaging	Het
Ccdc83	C	T	7: 90,224,034	G371D	probably damaging	Het
Cfap65	A	G	1: 74,926,604	S416P	probably damaging	Het
Cftr	T	A	6: 18,319,013	C1351S	probably damaging	Het
Clcn4	A	T	7: 7,291,828	H311Q	probably benign	Het
Cldn13	T	G	5: 134,915,020	I104L	probably benign	Het
Cul9	A	G	17: 46,510,909	V1880A	possibly damaging	Het
Ddx17	A	T	15: 79,531,904	D407E	probably damaging	Het
Ddx28	G	A	8: 106,011,325	P34S	probably damaging	Het
Dnah5	A	T	15: 28,270,470	N973Y	probably null	Het
Dock10	A	G	1: 80,549,704		probably null	Het
Dock3	T	C	9: 106,895,524	D510G	probably benign	Het
Dst	T	A	1: 34,191,094	D2589E	probably benign	Het
E2f7	T	C	10: 110,764,130	Y249H	not run	Het
Eef2kmt	T	C	16: 5,250,509	Y69C	possibly damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Exog	G	T	9: 119,462,478	V274L	possibly damaging	Het
Fam83e	G	A	7: 45,722,472	V98M	probably benign	Het
Fras1	C	T	5: 96,709,886	T2013I	probably benign	Het
Gart	G	T	16: 91,621,681	A970E	probably benign	Het
Gga2	T	A	7: 122,002,103	H259L	probably benign	Het
Glis3	C	A	19: 28,531,598	V329F	probably damaging	Het
Gm6356	T	A	14: 6,972,923	N53I	probably damaging	Het
Golgb1	C	A	16: 36,915,951	C1894*	probably null	Het
Ifi203	T	C	1: 173,929,167	N350S	unknown	Het
Isy1	T	A	6: 87,833,706	R55S	unknown	Het
Itsn1	A	T	16: 91,839,699	D678V	unknown	Het
Lhcgr	T	A	17: 88,742,078	R673S	probably benign	Het
Lnx2	C	A	5: 147,020,133	R601L	possibly damaging	Het
Map4	A	G	9: 110,081,517	T1093A	probably benign	Het
Mink1	A	G	11: 70,599,073	K92E	probably benign	Het
Moxd1	A	G	10: 24,301,465	I560V	probably benign	Het
Mrc2	C	A	11: 105,329,235	D327E	possibly damaging	Het
Notch2	A	G	3: 98,131,327	E1262G	possibly damaging	Het
Olfr1025-ps1	A	T	2: 85,918,374	I150F	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1298	A	G	2: 111,645,952	L15S	probably benign	Het
Olfr1434	G	A	19: 12,283,816	G256D	possibly damaging	Het
Olfr1477	T	A	19: 13,503,180	M279K	possibly damaging	Het
Olfr653	C	A	7: 104,580,438	S264*	probably null	Het
Olfr785	A	T	10: 129,409,785	T140S	possibly damaging	Het
Pcbp2	T	A	15: 102,473,347	V5E	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pgghg	A	T	7: 140,943,040	Y104F	probably benign	Het
Plscr2	T	C	9: 92,291,140		probably null	Het
Ppfibp1	C	T	6: 146,978,053	A25V	probably damaging	Het
Ptgfr	C	T	3: 151,835,397	G158D	probably benign	Het
Ptgs2	T	C	1: 150,102,695	F186S	probably damaging	Het
Ptpn14	A	G	1: 189,832,759	E181G	probably benign	Het
Rpgrip1	A	G	14: 52,131,216	K291E	possibly damaging	Het
Rtn4rl1	T	C	11: 75,194,296		probably null	Het
Sema3b	T	A	9: 107,600,942	M415L	probably benign	Het
Sh3bp4	A	G	1: 89,145,494	E688G	probably damaging	Het
Slco6c1	G	A	1: 97,128,162	R5C	possibly damaging	Het
Slmap	A	G	14: 26,460,072	F369L	possibly damaging	Het
Sphk2	T	C	7: 45,712,470	N181S	possibly damaging	Het
St13	A	G	15: 81,389,653	L80P	probably damaging	Het
St3gal6	A	G	16: 58,493,711	Y20H	probably benign	Het
Sun1	T	G	5: 139,248,484	Y899D	probably damaging	Het
Synm	C	T	7: 67,735,380	E845K	possibly damaging	Het
Tg	A	T	15: 66,694,784	D1227V	possibly damaging	Het
Thbs1	A	G	2: 118,114,957	N306D	possibly damaging	Het
Tmcc3	A	T	10: 94,578,495	N51Y	possibly damaging	Het
Usp4	A	G	9: 108,388,306	D856G	probably benign	Het
Vil1	G	A	1: 74,418,444	A79T	probably damaging	Het
Vmn1r119	T	A	7: 21,012,346	H37L	probably damaging	Het
Vmn2r110	A	T	17: 20,596,054	M69K	probably benign	Het
Wdr78	A	T	4: 103,050,187	I634N	possibly damaging	Het
Ywhaq	A	G	12: 21,394,981	L221P	probably damaging	Het
Zfp142	G	A	1: 74,570,008	Q1543*	probably null	Het
Zfp384	T	A	6: 125,024,830	M146K	possibly damaging	Het

Other mutations in Sqor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Sqor	APN	2	122787543	missense	probably damaging	0.97
IGL01544:Sqor	APN	2	122792346	splice site	probably benign
IGL02499:Sqor	APN	2	122808087	missense	possibly damaging	0.93
IGL02583:Sqor	APN	2	122799770	missense	probably damaging	0.98
IGL02732:Sqor	APN	2	122799762	missense	possibly damaging	0.76
IGL03137:Sqor	APN	2	122808071	missense	probably benign
H8786:Sqor	UTSW	2	122792368	missense	probably benign	0.10
R0126:Sqor	UTSW	2	122798027	unclassified	probably benign
R0410:Sqor	UTSW	2	122787522	missense	probably benign
R0502:Sqor	UTSW	2	122798050	missense	probably benign	0.04
R0709:Sqor	UTSW	2	122799855	missense	probably benign	0.38
R1486:Sqor	UTSW	2	122807645	splice site	probably null
R2001:Sqor	UTSW	2	122798098	missense	probably damaging	0.98
R2020:Sqor	UTSW	2	122804107	critical splice donor site	probably null
R2039:Sqor	UTSW	2	122792404	critical splice donor site	probably null
R2404:Sqor	UTSW	2	122808023	missense	probably benign
R4213:Sqor	UTSW	2	122787498	missense	probably damaging	1.00
R4909:Sqor	UTSW	2	122785181	missense	possibly damaging	0.82
R5630:Sqor	UTSW	2	122809357	missense	possibly damaging	0.71
R5659:Sqor	UTSW	2	122787603	missense	probably benign	0.02
R5728:Sqor	UTSW	2	122809400	makesense	probably null
R5772:Sqor	UTSW	2	122809341	missense	probably benign	0.00
R6527:Sqor	UTSW	2	122809286	missense	probably damaging	0.98
R6657:Sqor	UTSW	2	122807594	missense	possibly damaging	0.68
R6843:Sqor	UTSW	2	122784980	missense	probably benign	0.00
R6843:Sqor	UTSW	2	122809295	missense	probably damaging	0.99
R7193:Sqor	UTSW	2	122804009	missense	probably damaging	1.00
R7417:Sqor	UTSW	2	122787530	missense	probably benign	0.35
R7846:Sqor	UTSW	2	122785088	missense	probably benign	0.37
R8913:Sqor	UTSW	2	122799886	missense	probably benign
R8939:Sqor	UTSW	2	122807629	missense	possibly damaging	0.84
R9007:Sqor	UTSW	2	122807956	nonsense	probably null
R9030:Sqor	UTSW	2	122787594	missense	probably benign	0.14
R9447:Sqor	UTSW	2	122807600	missense	possibly damaging	0.83
R9790:Sqor	UTSW	2	122784992	missense	probably benign	0.00
R9791:Sqor	UTSW	2	122784992	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACTGCAGTGGGTCCTGTG -3'
(R):5'- GGCCACTCACAGGAATCACATG -3'

Sequencing Primer
(F):5'- GAGCTTTTGAAGTTCTACCAGC -3'
(R):5'- GGAATCACATGCGTCTCCC -3'

Posted On

2019-06-26