Incidental Mutation 'R7320:Notch2'
ID 568118
Institutional Source Beutler Lab
Gene Symbol Notch2
Ensembl Gene ENSMUSG00000027878
Gene Name notch 2
Synonyms N2, Motch B
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 98013527-98150361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98131327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1262 (E1262G)
Ref Sequence ENSEMBL: ENSMUSP00000078741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079812]
AlphaFold O35516
Predicted Effect possibly damaging
Transcript: ENSMUST00000079812
AA Change: E1262G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: E1262G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 27 63 5.79e-2 SMART
EGF 67 102 1.54e-6 SMART
EGF 108 143 6.25e-7 SMART
EGF 147 180 5.28e-5 SMART
EGF_CA 182 219 6.14e-15 SMART
EGF 224 258 5.08e-7 SMART
EGF_CA 260 296 1.95e-8 SMART
EGF_CA 298 336 3.91e-8 SMART
EGF_CA 338 374 7.69e-7 SMART
EGF 378 413 6.86e-4 SMART
EGF_CA 415 454 4.15e-12 SMART
EGF_CA 456 492 3.24e-14 SMART
EGF_CA 494 530 4.77e-12 SMART
EGF_CA 532 568 2.04e-11 SMART
EGF_CA 570 605 1.18e-7 SMART
EGF_CA 607 643 7.12e-11 SMART
EGF_CA 645 680 1.82e-8 SMART
EGF_CA 682 718 1.42e-10 SMART
EGF_CA 720 755 1.25e-6 SMART
EGF_CA 757 793 3.61e-12 SMART
EGF_CA 795 831 1.53e-10 SMART
EGF 836 871 1.34e-6 SMART
EGF_CA 873 909 6.05e-14 SMART
EGF_CA 911 947 9.54e-12 SMART
EGF_CA 949 985 1.39e-13 SMART
EGF_CA 987 1023 1.26e-11 SMART
EGF_CA 1025 1061 9.31e-15 SMART
EGF 1066 1099 1.39e-4 SMART
EGF 1104 1147 2.6e-4 SMART
EGF_CA 1149 1185 1.55e-11 SMART
EGF_CA 1187 1223 2.74e-12 SMART
EGF_CA 1225 1262 4.15e-12 SMART
EGF 1267 1302 1.43e-1 SMART
EGF 1307 1343 2.33e-6 SMART
EGF 1377 1412 9.85e-5 SMART
NL 1418 1456 8.55e-19 SMART
NL 1459 1497 2.27e-14 SMART
NL 1498 1535 1.16e-11 SMART
NOD 1539 1595 3.4e-28 SMART
NODP 1619 1679 1.66e-22 SMART
transmembrane domain 1680 1702 N/A INTRINSIC
ANK 1828 1872 2.18e2 SMART
ANK 1877 1906 3.36e-2 SMART
ANK 1910 1940 1.81e2 SMART
ANK 1944 1973 6.61e-1 SMART
ANK 1977 2006 5.24e-4 SMART
ANK 2010 2039 3.41e-3 SMART
low complexity region 2179 2193 N/A INTRINSIC
low complexity region 2232 2241 N/A INTRINSIC
DUF3454 2382 2447 4.62e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Notch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Notch2 APN 3 98111675 missense possibly damaging 0.77
IGL01517:Notch2 APN 3 98138655 missense probably benign 0.16
IGL01630:Notch2 APN 3 98146618 missense possibly damaging 0.77
IGL01637:Notch2 APN 3 98146060 missense probably damaging 1.00
IGL01828:Notch2 APN 3 98072613 missense probably damaging 1.00
IGL01998:Notch2 APN 3 98143106 missense probably damaging 1.00
IGL02008:Notch2 APN 3 98147296 missense probably damaging 1.00
IGL02030:Notch2 APN 3 98099421 splice site probably null
IGL02155:Notch2 APN 3 98138490 missense probably damaging 0.98
IGL02268:Notch2 APN 3 98137397 missense probably damaging 1.00
IGL02301:Notch2 APN 3 98141554 missense probably benign 0.08
IGL02336:Notch2 APN 3 98138395 missense possibly damaging 0.73
IGL02340:Notch2 APN 3 98147336 nonsense probably null
IGL02536:Notch2 APN 3 98102407 missense probably benign 0.03
IGL02589:Notch2 APN 3 98104347 critical splice acceptor site probably null
IGL02633:Notch2 APN 3 98116697 splice site probably benign
IGL02691:Notch2 APN 3 98135607 nonsense probably null
IGL02832:Notch2 APN 3 98137373 missense probably benign 0.12
IGL02894:Notch2 APN 3 98102432 nonsense probably null
IGL02902:Notch2 APN 3 98111574 missense probably damaging 1.00
IGL02967:Notch2 APN 3 98146144 missense probably damaging 0.99
IGL03015:Notch2 APN 3 98072649 missense possibly damaging 0.83
PIT4378001:Notch2 UTSW 3 98142956 missense probably damaging 1.00
PIT4519001:Notch2 UTSW 3 98098108 missense probably damaging 1.00
PIT4581001:Notch2 UTSW 3 98104462 missense probably damaging 1.00
R0111:Notch2 UTSW 3 98138761 missense probably benign 0.00
R0129:Notch2 UTSW 3 98146620 missense probably benign 0.08
R0143:Notch2 UTSW 3 98146117 missense probably damaging 0.99
R0480:Notch2 UTSW 3 98146537 missense possibly damaging 0.88
R0523:Notch2 UTSW 3 98070970 missense probably benign 0.34
R0523:Notch2 UTSW 3 98111598 missense probably benign 0.00
R0531:Notch2 UTSW 3 98102451 splice site probably benign
R0537:Notch2 UTSW 3 98116741 missense possibly damaging 0.70
R0987:Notch2 UTSW 3 98134677 splice site probably null
R1485:Notch2 UTSW 3 98100257 missense probably benign 0.00
R1555:Notch2 UTSW 3 98131340 missense possibly damaging 0.93
R1625:Notch2 UTSW 3 98111575 missense probably damaging 1.00
R1699:Notch2 UTSW 3 98145127 missense probably damaging 1.00
R1765:Notch2 UTSW 3 98121926 missense probably damaging 1.00
R1794:Notch2 UTSW 3 98099547 missense possibly damaging 0.53
R1974:Notch2 UTSW 3 98072755 missense probably damaging 1.00
R2086:Notch2 UTSW 3 98102367 missense probably damaging 1.00
R2099:Notch2 UTSW 3 98115321 missense possibly damaging 0.79
R3778:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R3924:Notch2 UTSW 3 98122034 nonsense probably null
R4018:Notch2 UTSW 3 98104565 missense probably damaging 1.00
R4151:Notch2 UTSW 3 98147071 missense possibly damaging 0.95
R4417:Notch2 UTSW 3 98131270 missense possibly damaging 0.95
R4510:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4511:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4636:Notch2 UTSW 3 98146104 missense probably benign 0.02
R4661:Notch2 UTSW 3 98135513 missense probably damaging 1.00
R4856:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4886:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4945:Notch2 UTSW 3 98111721 missense probably benign 0.01
R4970:Notch2 UTSW 3 98101636 critical splice donor site probably null
R4974:Notch2 UTSW 3 98139633 missense probably benign 0.39
R5082:Notch2 UTSW 3 98100374 missense probably damaging 1.00
R5112:Notch2 UTSW 3 98101636 critical splice donor site probably null
R5156:Notch2 UTSW 3 98124310 missense possibly damaging 0.53
R5433:Notch2 UTSW 3 98126134 missense probably damaging 1.00
R5539:Notch2 UTSW 3 98137582 missense probably damaging 0.99
R5813:Notch2 UTSW 3 98135428 missense probably benign
R5827:Notch2 UTSW 3 98072862 missense possibly damaging 0.64
R5908:Notch2 UTSW 3 98123923 intron probably benign
R6021:Notch2 UTSW 3 98121972 missense probably damaging 1.00
R6090:Notch2 UTSW 3 98135377 nonsense probably null
R6103:Notch2 UTSW 3 98135743 missense possibly damaging 0.94
R6111:Notch2 UTSW 3 98146293 missense probably benign 0.00
R6168:Notch2 UTSW 3 98145217 missense probably damaging 1.00
R6382:Notch2 UTSW 3 98141543 missense probably damaging 1.00
R6404:Notch2 UTSW 3 98081998 missense probably damaging 1.00
R6419:Notch2 UTSW 3 98100389 critical splice donor site probably null
R6454:Notch2 UTSW 3 98137406 missense possibly damaging 0.47
R6626:Notch2 UTSW 3 98101605 missense probably damaging 1.00
R6629:Notch2 UTSW 3 98120881 missense possibly damaging 0.65
R6706:Notch2 UTSW 3 98138430 missense possibly damaging 0.94
R6735:Notch2 UTSW 3 98134586 missense probably damaging 1.00
R6837:Notch2 UTSW 3 98070854 splice site probably null
R7021:Notch2 UTSW 3 98135446 missense probably benign
R7028:Notch2 UTSW 3 98102387 missense probably damaging 1.00
R7228:Notch2 UTSW 3 98137317 nonsense probably null
R7361:Notch2 UTSW 3 98131402 missense probably benign 0.04
R7562:Notch2 UTSW 3 98113114 missense probably damaging 1.00
R7630:Notch2 UTSW 3 98137508 missense possibly damaging 0.65
R7637:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R7748:Notch2 UTSW 3 98138484 missense possibly damaging 0.69
R7764:Notch2 UTSW 3 98142988 missense probably damaging 1.00
R7817:Notch2 UTSW 3 98107127 missense probably damaging 1.00
R7952:Notch2 UTSW 3 98100236 missense probably benign 0.30
R8136:Notch2 UTSW 3 98124221 missense probably damaging 1.00
R8159:Notch2 UTSW 3 98120922 missense possibly damaging 0.95
R8679:Notch2 UTSW 3 98121902 critical splice acceptor site probably null
R8879:Notch2 UTSW 3 98135599 missense possibly damaging 0.73
R9146:Notch2 UTSW 3 98104538 missense probably damaging 1.00
R9398:Notch2 UTSW 3 98102352 missense probably damaging 1.00
R9422:Notch2 UTSW 3 98147352 missense probably damaging 1.00
R9594:Notch2 UTSW 3 98134573 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTTGCTAATGGCGGGTTCAG -3'
(R):5'- CCTAAGCTGGTCTTGGCTTG -3'

Sequencing Primer
(F):5'- CGGGTTCAGTGGATTTTTGTAATTC -3'
(R):5'- TGCAGGAGGTCAGACATTTCC -3'
Posted On 2019-06-26