Mutagenetix > Incidental Mutation

Incidental Mutation 'R7320:5330417C22Rik'

568119

Institutional Source

Beutler Lab

Gene Symbol

5330417C22Rik

Ensembl Gene

ENSMUSG00000040412

Gene Name

RIKEN cDNA 5330417C22 gene

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R7320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108455694-108536536 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 108464303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 650 (K650*)

Ref Sequence

ENSEMBL: ENSMUSP00000040128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048012] [ENSMUST00000106625] [ENSMUST00000106626] [ENSMUST00000185128]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048012
AA Change: K650*

SMART Domains

Protein: ENSMUSP00000040128
Gene: ENSMUSG00000040412
AA Change: K650*

Domain	Start	End	E-Value	Type
internal_repeat_1	3	212	1.11e-6	PROSPERO
internal_repeat_1	289	522	1.11e-6	PROSPERO
transmembrane domain	806	828	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106625
AA Change: K752*

SMART Domains

Protein: ENSMUSP00000102236
Gene: ENSMUSG00000040412
AA Change: K752*

Domain	Start	End	E-Value	Type
signal peptide	1	41	N/A	INTRINSIC
internal_repeat_1	48	310	8.31e-11	PROSPERO
internal_repeat_1	325	620	8.31e-11	PROSPERO
transmembrane domain	904	926	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106626
AA Change: K702*

SMART Domains

Protein: ENSMUSP00000102237
Gene: ENSMUSG00000040412
AA Change: K702*

Domain	Start	End	E-Value	Type
signal peptide	1	41	N/A	INTRINSIC
internal_repeat_1	48	178	2.5e-7	PROSPERO
internal_repeat_1	275	421	2.5e-7	PROSPERO
transmembrane domain	854	876	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185128

SMART Domains

Protein: ENSMUSP00000138870
Gene: ENSMUSG00000040412

Domain	Start	End	E-Value	Type
low complexity region	25	31	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Expression of this gene is induced by estrogen and the encoded protein has been characterized as a transmembrane protein. The encoded protein has been found in to correlate with survival in certain carcinomas (PMID: 21102415) and may be important for cellular response to stress (PMID: 21072319). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Male homozygous mice are infertile. Microscopic analysis revealed defective spermatogenesis in the testis, and hypospermia and defective spermatozoa in the epididymides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,367,645	I458T	probably benign	Het
Adam29	A	G	8: 55,872,714	I235T	possibly damaging	Het
AF529169	A	G	9: 89,601,626	S573P	probably benign	Het
Afap1	G	A	5: 35,948,223	V174I	probably damaging	Het
Ak8	A	T	2: 28,812,992	D456V	probably damaging	Het
Alb	T	C	5: 90,464,987		probably null	Het
Alox12	C	T	11: 70,254,472	A92T	probably benign	Het
Arhgap23	T	C	11: 97,451,545	S218P	probably benign	Het
Blm	G	A	7: 80,455,354	Q1389*	probably null	Het
C1ql4	A	T	15: 99,087,724	V2E	unknown	Het
Casp12	A	G	9: 5,348,897		probably null	Het
Ccdc73	A	T	2: 104,999,176	I1065F	possibly damaging	Het
Ccdc83	C	T	7: 90,224,034	G371D	probably damaging	Het
Cfap65	A	G	1: 74,926,604	S416P	probably damaging	Het
Cftr	T	A	6: 18,319,013	C1351S	probably damaging	Het
Clcn4	A	T	7: 7,291,828	H311Q	probably benign	Het
Cldn13	T	G	5: 134,915,020	I104L	probably benign	Het
Cul9	A	G	17: 46,510,909	V1880A	possibly damaging	Het
Ddx17	A	T	15: 79,531,904	D407E	probably damaging	Het
Ddx28	G	A	8: 106,011,325	P34S	probably damaging	Het
Dnah5	A	T	15: 28,270,470	N973Y	probably null	Het
Dock10	A	G	1: 80,549,704		probably null	Het
Dock3	T	C	9: 106,895,524	D510G	probably benign	Het
Dst	T	A	1: 34,191,094	D2589E	probably benign	Het
E2f7	T	C	10: 110,764,130	Y249H	not run	Het
Eef2kmt	T	C	16: 5,250,509	Y69C	possibly damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Exog	G	T	9: 119,462,478	V274L	possibly damaging	Het
Fam83e	G	A	7: 45,722,472	V98M	probably benign	Het
Fras1	C	T	5: 96,709,886	T2013I	probably benign	Het
Gart	G	T	16: 91,621,681	A970E	probably benign	Het
Gga2	T	A	7: 122,002,103	H259L	probably benign	Het
Glis3	C	A	19: 28,531,598	V329F	probably damaging	Het
Gm6356	T	A	14: 6,972,923	N53I	probably damaging	Het
Golgb1	C	A	16: 36,915,951	C1894*	probably null	Het
Ifi203	T	C	1: 173,929,167	N350S	unknown	Het
Isy1	T	A	6: 87,833,706	R55S	unknown	Het
Itsn1	A	T	16: 91,839,699	D678V	unknown	Het
Lhcgr	T	A	17: 88,742,078	R673S	probably benign	Het
Lnx2	C	A	5: 147,020,133	R601L	possibly damaging	Het
Map4	A	G	9: 110,081,517	T1093A	probably benign	Het
Mink1	A	G	11: 70,599,073	K92E	probably benign	Het
Moxd1	A	G	10: 24,301,465	I560V	probably benign	Het
Mrc2	C	A	11: 105,329,235	D327E	possibly damaging	Het
Notch2	A	G	3: 98,131,327	E1262G	possibly damaging	Het
Olfr1025-ps1	A	T	2: 85,918,374	I150F	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1298	A	G	2: 111,645,952	L15S	probably benign	Het
Olfr1434	G	A	19: 12,283,816	G256D	possibly damaging	Het
Olfr1477	T	A	19: 13,503,180	M279K	possibly damaging	Het
Olfr653	C	A	7: 104,580,438	S264*	probably null	Het
Olfr785	A	T	10: 129,409,785	T140S	possibly damaging	Het
Pcbp2	T	A	15: 102,473,347	V5E	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pgghg	A	T	7: 140,943,040	Y104F	probably benign	Het
Plscr2	T	C	9: 92,291,140		probably null	Het
Ppfibp1	C	T	6: 146,978,053	A25V	probably damaging	Het
Ptgfr	C	T	3: 151,835,397	G158D	probably benign	Het
Ptgs2	T	C	1: 150,102,695	F186S	probably damaging	Het
Ptpn14	A	G	1: 189,832,759	E181G	probably benign	Het
Rpgrip1	A	G	14: 52,131,216	K291E	possibly damaging	Het
Rtn4rl1	T	C	11: 75,194,296		probably null	Het
Sema3b	T	A	9: 107,600,942	M415L	probably benign	Het
Sh3bp4	A	G	1: 89,145,494	E688G	probably damaging	Het
Slco6c1	G	A	1: 97,128,162	R5C	possibly damaging	Het
Slmap	A	G	14: 26,460,072	F369L	possibly damaging	Het
Sphk2	T	C	7: 45,712,470	N181S	possibly damaging	Het
Sqor	A	G	2: 122,799,810	T235A	probably benign	Het
St13	A	G	15: 81,389,653	L80P	probably damaging	Het
St3gal6	A	G	16: 58,493,711	Y20H	probably benign	Het
Sun1	T	G	5: 139,248,484	Y899D	probably damaging	Het
Synm	C	T	7: 67,735,380	E845K	possibly damaging	Het
Tg	A	T	15: 66,694,784	D1227V	possibly damaging	Het
Thbs1	A	G	2: 118,114,957	N306D	possibly damaging	Het
Tmcc3	A	T	10: 94,578,495	N51Y	possibly damaging	Het
Usp4	A	G	9: 108,388,306	D856G	probably benign	Het
Vil1	G	A	1: 74,418,444	A79T	probably damaging	Het
Vmn1r119	T	A	7: 21,012,346	H37L	probably damaging	Het
Vmn2r110	A	T	17: 20,596,054	M69K	probably benign	Het
Wdr78	A	T	4: 103,050,187	I634N	possibly damaging	Het
Ywhaq	A	G	12: 21,394,981	L221P	probably damaging	Het
Zfp142	G	A	1: 74,570,008	Q1543*	probably null	Het
Zfp384	T	A	6: 125,024,830	M146K	possibly damaging	Het

Other mutations in 5330417C22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01552:5330417C22Rik	APN	3	108481312	missense	possibly damaging	0.48
IGL02079:5330417C22Rik	APN	3	108481359	missense	possibly damaging	0.91
IGL02268:5330417C22Rik	APN	3	108467797	missense	probably benign	0.00
IGL02869:5330417C22Rik	APN	3	108472866	missense	probably benign	0.34
IGL02891:5330417C22Rik	APN	3	108464392	missense	probably benign	0.03
IGL03088:5330417C22Rik	APN	3	108536358	missense	probably damaging	1.00
IGL03345:5330417C22Rik	APN	3	108492016	missense	possibly damaging	0.68
IGL03398:5330417C22Rik	APN	3	108461221	missense	possibly damaging	0.94
IGL03138:5330417C22Rik	UTSW	3	108471993	missense	probably benign	0.08
R0325:5330417C22Rik	UTSW	3	108461251	missense	probably damaging	1.00
R0730:5330417C22Rik	UTSW	3	108469535	missense	probably benign	0.00
R0844:5330417C22Rik	UTSW	3	108480963	splice site	probably benign
R1646:5330417C22Rik	UTSW	3	108462990	missense	probably damaging	1.00
R1666:5330417C22Rik	UTSW	3	108469997	missense	probably benign	0.01
R1726:5330417C22Rik	UTSW	3	108467868	missense	possibly damaging	0.67
R2202:5330417C22Rik	UTSW	3	108475043	missense	probably damaging	1.00
R2203:5330417C22Rik	UTSW	3	108475043	missense	probably damaging	1.00
R2204:5330417C22Rik	UTSW	3	108475043	missense	probably damaging	1.00
R2205:5330417C22Rik	UTSW	3	108475043	missense	probably damaging	1.00
R2249:5330417C22Rik	UTSW	3	108471410	nonsense	probably null
R2443:5330417C22Rik	UTSW	3	108481349	missense	probably damaging	1.00
R3965:5330417C22Rik	UTSW	3	108458449	missense	probably damaging	1.00
R4171:5330417C22Rik	UTSW	3	108460943	missense	probably benign	0.30
R4785:5330417C22Rik	UTSW	3	108458227	utr 3 prime	probably benign
R4810:5330417C22Rik	UTSW	3	108470011	splice site	probably benign
R4862:5330417C22Rik	UTSW	3	108467833	missense	probably benign
R4923:5330417C22Rik	UTSW	3	108471968	critical splice donor site	probably null
R5040:5330417C22Rik	UTSW	3	108475001	missense	probably damaging	1.00
R5153:5330417C22Rik	UTSW	3	108472747	missense	possibly damaging	0.75
R5405:5330417C22Rik	UTSW	3	108467786	nonsense	probably null
R5609:5330417C22Rik	UTSW	3	108471415	missense	probably damaging	0.96
R5663:5330417C22Rik	UTSW	3	108492083	missense	probably benign	0.00
R6194:5330417C22Rik	UTSW	3	108465779	missense	probably benign	0.05
R6303:5330417C22Rik	UTSW	3	108461256	missense	probably damaging	1.00
R6304:5330417C22Rik	UTSW	3	108461256	missense	probably damaging	1.00
R6381:5330417C22Rik	UTSW	3	108481814	missense	possibly damaging	0.52
R6676:5330417C22Rik	UTSW	3	108469915	missense	probably damaging	1.00
R6852:5330417C22Rik	UTSW	3	108482338	missense	probably damaging	1.00
R7221:5330417C22Rik	UTSW	3	108475001	missense	possibly damaging	0.92
R7384:5330417C22Rik	UTSW	3	108463468	critical splice donor site	probably null
R7542:5330417C22Rik	UTSW	3	108458227	utr 3 prime	probably benign
R7597:5330417C22Rik	UTSW	3	108471429	missense	possibly damaging	0.93
R7674:5330417C22Rik	UTSW	3	108462991	missense	probably damaging	1.00
R8076:5330417C22Rik	UTSW	3	108492082	missense	probably benign	0.11
R8426:5330417C22Rik	UTSW	3	108471426	missense	probably damaging	1.00
R9028:5330417C22Rik	UTSW	3	108463503	missense	probably benign	0.15
R9255:5330417C22Rik	UTSW	3	108469548	missense	probably damaging	1.00
R9573:5330417C22Rik	UTSW	3	108465778	missense	probably damaging	0.98
R9659:5330417C22Rik	UTSW	3	108469981	missense	possibly damaging	0.91
R9788:5330417C22Rik	UTSW	3	108469981	missense	possibly damaging	0.91
X0022:5330417C22Rik	UTSW	3	108459746	missense	probably damaging	1.00
Z1176:5330417C22Rik	UTSW	3	108471435	missense	probably damaging	1.00
Z1176:5330417C22Rik	UTSW	3	108471978	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCACCAGCCTCATATTTG -3'
(R):5'- GGACTCTTCTGTGATCATTTGC -3'

Sequencing Primer
(F):5'- TATACATATACAGAGGCGTGCAC -3'
(R):5'- GTGATCATTTGCTTTCTTCCACGTG -3'

Posted On

2019-06-26