Incidental Mutation 'R7320:Cftr'
ID 568128
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Name cystic fibrosis transmembrane conductance regulator
Synonyms Abcc7
MMRRC Submission 045370-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R7320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 18170686-18322767 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18319012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1351 (C1351S)
Ref Sequence ENSEMBL: ENSMUSP00000049228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000140407]
AlphaFold P26361
PDB Structure mouse CFTR NBD1 with AMP.PNP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) apo [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ADP [X-RAY DIFFRACTION]
Phosphorylated Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP, I4122 space group [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508S mutant [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508R mutant [X-RAY DIFFRACTION]
The crystal structure of the NBD1 domain of the mouse CFTR protein, deltaF508 mutant [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045706
AA Change: C1351S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: C1351S

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115405
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115406
AA Change: C1321S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: C1321S

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140407
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,258,471 (GRCm39) I458T probably benign Het
Adam29 A G 8: 56,325,749 (GRCm39) I235T possibly damaging Het
Afap1 G A 5: 36,105,567 (GRCm39) V174I probably damaging Het
Ak8 A T 2: 28,703,004 (GRCm39) D456V probably damaging Het
Alb T C 5: 90,612,846 (GRCm39) probably null Het
Alox12 C T 11: 70,145,298 (GRCm39) A92T probably benign Het
Arhgap23 T C 11: 97,342,371 (GRCm39) S218P probably benign Het
Blm G A 7: 80,105,102 (GRCm39) Q1389* probably null Het
C1ql4 A T 15: 98,985,605 (GRCm39) V2E unknown Het
Casp12 A G 9: 5,348,897 (GRCm39) probably null Het
Ccdc73 A T 2: 104,829,521 (GRCm39) I1065F possibly damaging Het
Ccdc83 C T 7: 89,873,242 (GRCm39) G371D probably damaging Het
Cfap65 A G 1: 74,965,763 (GRCm39) S416P probably damaging Het
Clcn4 A T 7: 7,294,827 (GRCm39) H311Q probably benign Het
Cldn13 T G 5: 134,943,874 (GRCm39) I104L probably benign Het
Cul9 A G 17: 46,821,835 (GRCm39) V1880A possibly damaging Het
Ddx17 A T 15: 79,416,105 (GRCm39) D407E probably damaging Het
Ddx28 G A 8: 106,737,957 (GRCm39) P34S probably damaging Het
Dnah5 A T 15: 28,270,616 (GRCm39) N973Y probably null Het
Dnai4 A T 4: 102,907,384 (GRCm39) I634N possibly damaging Het
Dock10 A G 1: 80,527,421 (GRCm39) probably null Het
Dock3 T C 9: 106,772,723 (GRCm39) D510G probably benign Het
Dst T A 1: 34,230,175 (GRCm39) D2589E probably benign Het
E2f7 T C 10: 110,599,991 (GRCm39) Y249H not run Het
Eef2kmt T C 16: 5,068,373 (GRCm39) Y69C possibly damaging Het
Elapor1 T A 3: 108,371,619 (GRCm39) K650* probably null Het
Erlin1 T C 19: 44,047,504 (GRCm39) Y139C probably damaging Het
Exog G T 9: 119,291,544 (GRCm39) V274L possibly damaging Het
Fam83e G A 7: 45,371,896 (GRCm39) V98M probably benign Het
Fras1 C T 5: 96,857,745 (GRCm39) T2013I probably benign Het
Gart G T 16: 91,418,569 (GRCm39) A970E probably benign Het
Gga2 T A 7: 121,601,326 (GRCm39) H259L probably benign Het
Glis3 C A 19: 28,508,998 (GRCm39) V329F probably damaging Het
Gm6356 T A 14: 6,972,923 (GRCm38) N53I probably damaging Het
Golgb1 C A 16: 36,736,313 (GRCm39) C1894* probably null Het
Ifi203 T C 1: 173,756,733 (GRCm39) N350S unknown Het
Isy1 T A 6: 87,810,688 (GRCm39) R55S unknown Het
Itsn1 A T 16: 91,636,587 (GRCm39) D678V unknown Het
Lhcgr T A 17: 89,049,506 (GRCm39) R673S probably benign Het
Lnx2 C A 5: 146,956,943 (GRCm39) R601L possibly damaging Het
Map4 A G 9: 109,910,585 (GRCm39) T1093A probably benign Het
Minar1 A G 9: 89,483,679 (GRCm39) S573P probably benign Het
Mink1 A G 11: 70,489,899 (GRCm39) K92E probably benign Het
Moxd1 A G 10: 24,177,363 (GRCm39) I560V probably benign Het
Mrc2 C A 11: 105,220,061 (GRCm39) D327E possibly damaging Het
Notch2 A G 3: 98,038,643 (GRCm39) E1262G possibly damaging Het
Or2g1 T A 17: 38,107,248 (GRCm39) N304K probably benign Het
Or4k48 A G 2: 111,476,297 (GRCm39) L15S probably benign Het
Or52d3 C A 7: 104,229,645 (GRCm39) S264* probably null Het
Or5an1 G A 19: 12,261,180 (GRCm39) G256D possibly damaging Het
Or5b120 T A 19: 13,480,544 (GRCm39) M279K possibly damaging Het
Or5j3 GTACTTTTT GT 2: 86,128,338 (GRCm39) probably null Het
Or5m13 A T 2: 85,748,718 (GRCm39) I150F probably benign Het
Or6c5b A T 10: 129,245,654 (GRCm39) T140S possibly damaging Het
Pcbp2 T A 15: 102,381,782 (GRCm39) V5E probably damaging Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pgghg A T 7: 140,522,953 (GRCm39) Y104F probably benign Het
Plscr2 T C 9: 92,173,193 (GRCm39) probably null Het
Ppfibp1 C T 6: 146,879,551 (GRCm39) A25V probably damaging Het
Ptgfr C T 3: 151,541,034 (GRCm39) G158D probably benign Het
Ptgs2 T C 1: 149,978,446 (GRCm39) F186S probably damaging Het
Ptpn14 A G 1: 189,564,956 (GRCm39) E181G probably benign Het
Rpgrip1 A G 14: 52,368,673 (GRCm39) K291E possibly damaging Het
Rtn4rl1 T C 11: 75,085,122 (GRCm39) probably null Het
Sema3b T A 9: 107,478,141 (GRCm39) M415L probably benign Het
Sh3bp4 A G 1: 89,073,216 (GRCm39) E688G probably damaging Het
Slco6c1 G A 1: 97,055,887 (GRCm39) R5C possibly damaging Het
Slmap A G 14: 26,181,227 (GRCm39) F369L possibly damaging Het
Sphk2 T C 7: 45,361,894 (GRCm39) N181S possibly damaging Het
Sqor A G 2: 122,641,730 (GRCm39) T235A probably benign Het
St13 A G 15: 81,273,854 (GRCm39) L80P probably damaging Het
St3gal6 A G 16: 58,314,074 (GRCm39) Y20H probably benign Het
Sun1 T G 5: 139,234,239 (GRCm39) Y899D probably damaging Het
Synm C T 7: 67,385,128 (GRCm39) E845K possibly damaging Het
Tg A T 15: 66,566,633 (GRCm39) D1227V possibly damaging Het
Thbs1 A G 2: 117,945,438 (GRCm39) N306D possibly damaging Het
Tmcc3 A T 10: 94,414,357 (GRCm39) N51Y possibly damaging Het
Usp4 A G 9: 108,265,505 (GRCm39) D856G probably benign Het
Vil1 G A 1: 74,457,603 (GRCm39) A79T probably damaging Het
Vmn1r119 T A 7: 20,746,271 (GRCm39) H37L probably damaging Het
Vmn2r110 A T 17: 20,816,316 (GRCm39) M69K probably benign Het
Ywhaq A G 12: 21,444,982 (GRCm39) L221P probably damaging Het
Zfp142 G A 1: 74,609,167 (GRCm39) Q1543* probably null Het
Zfp384 T A 6: 125,001,793 (GRCm39) M146K possibly damaging Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18,268,429 (GRCm39) critical splice donor site probably null
IGL01082:Cftr APN 6 18,226,102 (GRCm39) missense probably damaging 0.97
IGL01113:Cftr APN 6 18,270,252 (GRCm39) missense probably damaging 1.00
IGL01383:Cftr APN 6 18,226,040 (GRCm39) missense probably benign 0.00
IGL01595:Cftr APN 6 18,198,238 (GRCm39) splice site probably benign
IGL01820:Cftr APN 6 18,226,138 (GRCm39) missense probably damaging 1.00
IGL02223:Cftr APN 6 18,221,481 (GRCm39) missense probably damaging 1.00
IGL02249:Cftr APN 6 18,277,870 (GRCm39) missense possibly damaging 0.58
IGL02439:Cftr APN 6 18,258,237 (GRCm39) nonsense probably null
IGL02537:Cftr APN 6 18,274,596 (GRCm39) missense probably benign 0.31
IGL03234:Cftr APN 6 18,225,987 (GRCm39) missense probably damaging 0.96
BB004:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
BB014:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
PIT4453001:Cftr UTSW 6 18,214,105 (GRCm39) missense probably damaging 0.99
PIT4520001:Cftr UTSW 6 18,277,842 (GRCm39) missense probably benign 0.01
R0114:Cftr UTSW 6 18,282,447 (GRCm39) missense probably damaging 1.00
R0329:Cftr UTSW 6 18,226,096 (GRCm39) missense probably null 1.00
R0330:Cftr UTSW 6 18,226,096 (GRCm39) missense probably null 1.00
R0331:Cftr UTSW 6 18,235,225 (GRCm39) missense possibly damaging 0.72
R0480:Cftr UTSW 6 18,274,517 (GRCm39) splice site probably benign
R0612:Cftr UTSW 6 18,198,125 (GRCm39) missense probably benign 0.01
R0633:Cftr UTSW 6 18,305,979 (GRCm39) missense probably damaging 0.99
R0830:Cftr UTSW 6 18,270,224 (GRCm39) missense probably benign 0.02
R1559:Cftr UTSW 6 18,225,936 (GRCm39) missense probably benign 0.01
R1629:Cftr UTSW 6 18,226,105 (GRCm39) missense probably damaging 1.00
R1636:Cftr UTSW 6 18,226,156 (GRCm39) missense probably damaging 0.99
R1860:Cftr UTSW 6 18,268,288 (GRCm39) missense probably benign 0.00
R2043:Cftr UTSW 6 18,320,934 (GRCm39) missense probably benign
R2211:Cftr UTSW 6 18,214,279 (GRCm39) missense probably null 0.13
R4737:Cftr UTSW 6 18,299,882 (GRCm39) missense probably benign 0.19
R4793:Cftr UTSW 6 18,226,087 (GRCm39) missense probably damaging 1.00
R4857:Cftr UTSW 6 18,320,974 (GRCm39) missense possibly damaging 0.92
R4984:Cftr UTSW 6 18,235,198 (GRCm39) missense possibly damaging 0.89
R4999:Cftr UTSW 6 18,221,613 (GRCm39) missense probably benign 0.17
R5045:Cftr UTSW 6 18,230,080 (GRCm39) missense probably benign 0.20
R5183:Cftr UTSW 6 18,299,832 (GRCm39) missense probably damaging 0.99
R5197:Cftr UTSW 6 18,255,413 (GRCm39) missense probably benign 0.00
R5288:Cftr UTSW 6 18,226,128 (GRCm39) nonsense probably null
R5337:Cftr UTSW 6 18,319,058 (GRCm39) missense probably damaging 1.00
R5549:Cftr UTSW 6 18,227,953 (GRCm39) missense probably benign 0.00
R5596:Cftr UTSW 6 18,268,095 (GRCm39) missense probably benign 0.00
R5651:Cftr UTSW 6 18,255,364 (GRCm39) splice site probably null
R5660:Cftr UTSW 6 18,313,686 (GRCm39) missense probably benign 0.22
R5941:Cftr UTSW 6 18,313,645 (GRCm39) missense probably damaging 1.00
R6221:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6222:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6229:Cftr UTSW 6 18,220,683 (GRCm39) missense probably damaging 1.00
R6256:Cftr UTSW 6 18,274,660 (GRCm39) missense probably damaging 0.96
R6257:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6412:Cftr UTSW 6 18,285,603 (GRCm39) missense probably damaging 0.97
R6459:Cftr UTSW 6 18,258,235 (GRCm39) missense probably damaging 1.00
R6558:Cftr UTSW 6 18,222,527 (GRCm39) missense probably damaging 1.00
R6724:Cftr UTSW 6 18,255,973 (GRCm39) nonsense probably null
R6787:Cftr UTSW 6 18,274,607 (GRCm39) nonsense probably null
R6861:Cftr UTSW 6 18,268,107 (GRCm39) missense probably benign 0.00
R6888:Cftr UTSW 6 18,313,729 (GRCm39) critical splice donor site probably null
R7084:Cftr UTSW 6 18,226,137 (GRCm39) missense probably benign 0.17
R7105:Cftr UTSW 6 18,318,971 (GRCm39) missense probably damaging 1.00
R7359:Cftr UTSW 6 18,221,623 (GRCm39) missense probably benign 0.00
R7466:Cftr UTSW 6 18,227,972 (GRCm39) missense probably benign
R7502:Cftr UTSW 6 18,214,295 (GRCm39) missense probably damaging 1.00
R7748:Cftr UTSW 6 18,277,888 (GRCm39) critical splice donor site probably null
R7808:Cftr UTSW 6 18,204,204 (GRCm39) missense probably benign
R7817:Cftr UTSW 6 18,267,967 (GRCm39) missense probably damaging 0.97
R7927:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
R7968:Cftr UTSW 6 18,226,048 (GRCm39) missense probably benign 0.00
R7995:Cftr UTSW 6 18,214,155 (GRCm39) missense probably damaging 1.00
R8171:Cftr UTSW 6 18,258,287 (GRCm39) missense probably damaging 1.00
R8210:Cftr UTSW 6 18,220,696 (GRCm39) missense probably damaging 1.00
R8548:Cftr UTSW 6 18,273,698 (GRCm39) missense possibly damaging 0.87
R8712:Cftr UTSW 6 18,274,696 (GRCm39) missense probably damaging 0.99
R8737:Cftr UTSW 6 18,319,728 (GRCm39) missense probably damaging 1.00
R8926:Cftr UTSW 6 18,268,003 (GRCm39) missense possibly damaging 0.83
R8979:Cftr UTSW 6 18,227,947 (GRCm39) missense probably benign 0.10
R8996:Cftr UTSW 6 18,255,945 (GRCm39) nonsense probably null
R9087:Cftr UTSW 6 18,214,180 (GRCm39) missense possibly damaging 0.91
R9115:Cftr UTSW 6 18,235,310 (GRCm39) missense probably damaging 1.00
R9406:Cftr UTSW 6 18,299,866 (GRCm39) missense probably benign 0.00
R9689:Cftr UTSW 6 18,313,649 (GRCm39) missense probably damaging 0.99
R9700:Cftr UTSW 6 18,268,359 (GRCm39) missense probably damaging 1.00
R9747:Cftr UTSW 6 18,285,636 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TCCAGTCTGTTTAGAGCTACCG -3'
(R):5'- CCCTACTTGTAGGTGTGGTAGC -3'

Sequencing Primer
(F):5'- CATGTCTGCTTTTAGAATGCAAGCC -3'
(R):5'- GTAGCTGAATGGGAATTTGTACC -3'
Posted On 2019-06-26