Incidental Mutation 'R7320:Zfp384'
ID568130
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Namezinc finger protein 384
SynonymsC130073D16Rik, Nmp4, Ciz
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R7320 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125009145-125037870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125024830 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 146 (M146K)
Ref Sequence ENSEMBL: ENSMUSP00000081296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428] [ENSMUST00000152752] [ENSMUST00000152752]
AlphaFold E9Q1A5
Predicted Effect possibly damaging
Transcript: ENSMUST00000046064
AA Change: M146K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054553
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084275
AA Change: M146K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088308
AA Change: M146K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112424
AA Change: M130K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346
AA Change: M130K

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112425
AA Change: M146K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112427
AA Change: M146K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112428
AA Change: M146K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346
AA Change: M146K

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152752
Predicted Effect probably null
Transcript: ENSMUST00000152752
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125025053 missense probably benign 0.03
IGL01568:Zfp384 APN 6 125024132 missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125024761 missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125035713 missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125036493 unclassified probably benign
FR4340:Zfp384 UTSW 6 125036463 unclassified probably benign
R0839:Zfp384 UTSW 6 125036668 missense probably benign 0.01
R1370:Zfp384 UTSW 6 125036453 missense probably benign 0.04
R1427:Zfp384 UTSW 6 125024884 missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125036649 missense probably benign 0.01
R2986:Zfp384 UTSW 6 125024896 missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125033237 splice site probably benign
R4833:Zfp384 UTSW 6 125030848 missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125030930 synonymous silent
R5084:Zfp384 UTSW 6 125023679 splice site probably benign
R5137:Zfp384 UTSW 6 125036509 unclassified probably benign
R5449:Zfp384 UTSW 6 125024138 missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125036509 unclassified probably benign
R5720:Zfp384 UTSW 6 125036624 missense probably benign 0.19
R5849:Zfp384 UTSW 6 125024099 missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125024034 missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125024933 splice site probably null
R6948:Zfp384 UTSW 6 125024910 missense probably benign 0.08
R7106:Zfp384 UTSW 6 125024259 missense probably benign 0.23
R7192:Zfp384 UTSW 6 125033312 missense probably damaging 1.00
R7730:Zfp384 UTSW 6 125031672 missense probably benign 0.02
R7861:Zfp384 UTSW 6 125036325 missense probably damaging 1.00
R8080:Zfp384 UTSW 6 125036558 missense unknown
R9021:Zfp384 UTSW 6 125036373 missense
RF002:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036476 unclassified probably benign
RF003:Zfp384 UTSW 6 125036483 unclassified probably benign
RF010:Zfp384 UTSW 6 125036471 unclassified probably benign
RF010:Zfp384 UTSW 6 125036488 unclassified probably benign
RF011:Zfp384 UTSW 6 125036476 unclassified probably benign
RF014:Zfp384 UTSW 6 125036466 unclassified probably benign
RF015:Zfp384 UTSW 6 125036481 unclassified probably benign
RF018:Zfp384 UTSW 6 125036489 unclassified probably benign
RF020:Zfp384 UTSW 6 125036455 unclassified probably benign
RF020:Zfp384 UTSW 6 125036488 unclassified probably benign
RF022:Zfp384 UTSW 6 125036471 unclassified probably benign
RF024:Zfp384 UTSW 6 125036489 unclassified probably benign
RF026:Zfp384 UTSW 6 125036492 unclassified probably benign
RF027:Zfp384 UTSW 6 125036490 unclassified probably benign
RF030:Zfp384 UTSW 6 125036483 unclassified probably benign
RF056:Zfp384 UTSW 6 125036490 unclassified probably benign
RF057:Zfp384 UTSW 6 125036496 unclassified probably benign
RF062:Zfp384 UTSW 6 125036466 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGATTTCCTGTAGACTGGGC -3'
(R):5'- GGTCATTCATCTCAGGAAGCC -3'

Sequencing Primer
(F):5'- CCTGTAGACTGGGCTGGAG -3'
(R):5'- AGGAAGCCCTGACTCCAG -3'
Posted On2019-06-26