Incidental Mutation 'R7320:Ppfibp1'
ID568131
Institutional Source Beutler Lab
Gene Symbol Ppfibp1
Ensembl Gene ENSMUSG00000016487
Gene NamePTPRF interacting protein, binding protein 1 (liprin beta 1)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R7320 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location146888487-147032025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 146978053 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 25 (A25V)
Ref Sequence ENSEMBL: ENSMUSP00000107250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000111623] [ENSMUST00000203730] [ENSMUST00000204660]
Predicted Effect probably damaging
Transcript: ENSMUST00000016631
AA Change: A25V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487
AA Change: A25V

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111623
AA Change: A25V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487
AA Change: A25V

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203730
AA Change: A25V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000204660
AA Change: A25V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144887
Gene: ENSMUSG00000016487
AA Change: A25V

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
coiled coil region 99 130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein was found to interact with S100A4, a calcium-binding protein related to tumor invasiveness and metastasis. In vitro experiment demonstrated that the interaction inhibited the phosphorylation of this protein by protein kinase C and protein kinase CK2. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Ppfibp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ppfibp1 APN 6 147029697 missense probably benign 0.07
IGL02644:Ppfibp1 APN 6 147022440 missense probably damaging 1.00
IGL02711:Ppfibp1 APN 6 147026238 nonsense probably null
IGL02737:Ppfibp1 APN 6 147027308 missense probably damaging 1.00
IGL02745:Ppfibp1 APN 6 147022354 unclassified probably benign
IGL03120:Ppfibp1 APN 6 146998169 missense probably benign 0.00
IGL03300:Ppfibp1 APN 6 147030327 missense probably damaging 1.00
R0114:Ppfibp1 UTSW 6 146998233 missense probably benign 0.04
R0480:Ppfibp1 UTSW 6 147019031 splice site probably null
R0699:Ppfibp1 UTSW 6 147026222 missense probably damaging 0.99
R1515:Ppfibp1 UTSW 6 147027432 missense probably benign
R1830:Ppfibp1 UTSW 6 147022259 critical splice donor site probably null
R1858:Ppfibp1 UTSW 6 146990592 missense probably benign 0.06
R2160:Ppfibp1 UTSW 6 147027453 missense probably damaging 0.98
R2389:Ppfibp1 UTSW 6 147022171 missense probably damaging 1.00
R2517:Ppfibp1 UTSW 6 146992444 missense probably damaging 1.00
R3882:Ppfibp1 UTSW 6 146998221 missense possibly damaging 0.67
R4035:Ppfibp1 UTSW 6 146996836 missense probably damaging 0.99
R4202:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4205:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4420:Ppfibp1 UTSW 6 147026238 nonsense probably null
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4974:Ppfibp1 UTSW 6 147030419 utr 3 prime probably benign
R5163:Ppfibp1 UTSW 6 147022131 splice site probably null
R5180:Ppfibp1 UTSW 6 147027321 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 146996840 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 147016330 missense probably damaging 1.00
R5458:Ppfibp1 UTSW 6 147012435 intron probably benign
R5479:Ppfibp1 UTSW 6 147030150 critical splice donor site probably null
R5631:Ppfibp1 UTSW 6 146996860 missense probably damaging 1.00
R6277:Ppfibp1 UTSW 6 147005924 missense probably benign 0.01
R6577:Ppfibp1 UTSW 6 146999655 splice site probably null
R6602:Ppfibp1 UTSW 6 146978221 missense possibly damaging 0.62
R7440:Ppfibp1 UTSW 6 147019503 missense probably benign 0.01
R7455:Ppfibp1 UTSW 6 147016350 missense probably damaging 1.00
R7710:Ppfibp1 UTSW 6 146996405 missense probably benign 0.00
R8379:Ppfibp1 UTSW 6 147030345 missense probably damaging 1.00
R8439:Ppfibp1 UTSW 6 147000950 missense possibly damaging 0.94
R8692:Ppfibp1 UTSW 6 146990515 missense probably benign 0.00
R8913:Ppfibp1 UTSW 6 147022449 missense probably damaging 0.99
R8926:Ppfibp1 UTSW 6 147019488 missense probably damaging 1.00
R8943:Ppfibp1 UTSW 6 147019183 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCTTTTCATTAAGCATCAAACC -3'
(R):5'- CACTTCTGCTGTTGAATCTGG -3'

Sequencing Primer
(F):5'- GCATCAAACCATTCATATTTACTGTC -3'
(R):5'- GGGATCTGGCATCTCAATCC -3'
Posted On2019-06-26