Incidental Mutation 'R7320:Clcn4'
ID 568132
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Name chloride channel, voltage-sensitive 4
Synonyms Clc4-2, Clcn4-2
MMRRC Submission 045370-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 7285308-7303837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7294827 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 311 (H311Q)
Ref Sequence ENSEMBL: ENSMUSP00000000619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
AlphaFold Q61418
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: H311Q

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: H311Q

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209916
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: H311Q

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000210362
Predicted Effect probably benign
Transcript: ENSMUST00000210594
AA Change: H251Q

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,258,471 (GRCm39) I458T probably benign Het
Adam29 A G 8: 56,325,749 (GRCm39) I235T possibly damaging Het
Afap1 G A 5: 36,105,567 (GRCm39) V174I probably damaging Het
Ak8 A T 2: 28,703,004 (GRCm39) D456V probably damaging Het
Alb T C 5: 90,612,846 (GRCm39) probably null Het
Alox12 C T 11: 70,145,298 (GRCm39) A92T probably benign Het
Arhgap23 T C 11: 97,342,371 (GRCm39) S218P probably benign Het
Blm G A 7: 80,105,102 (GRCm39) Q1389* probably null Het
C1ql4 A T 15: 98,985,605 (GRCm39) V2E unknown Het
Casp12 A G 9: 5,348,897 (GRCm39) probably null Het
Ccdc73 A T 2: 104,829,521 (GRCm39) I1065F possibly damaging Het
Ccdc83 C T 7: 89,873,242 (GRCm39) G371D probably damaging Het
Cfap65 A G 1: 74,965,763 (GRCm39) S416P probably damaging Het
Cftr T A 6: 18,319,012 (GRCm39) C1351S probably damaging Het
Cldn13 T G 5: 134,943,874 (GRCm39) I104L probably benign Het
Cul9 A G 17: 46,821,835 (GRCm39) V1880A possibly damaging Het
Ddx17 A T 15: 79,416,105 (GRCm39) D407E probably damaging Het
Ddx28 G A 8: 106,737,957 (GRCm39) P34S probably damaging Het
Dnah5 A T 15: 28,270,616 (GRCm39) N973Y probably null Het
Dnai4 A T 4: 102,907,384 (GRCm39) I634N possibly damaging Het
Dock10 A G 1: 80,527,421 (GRCm39) probably null Het
Dock3 T C 9: 106,772,723 (GRCm39) D510G probably benign Het
Dst T A 1: 34,230,175 (GRCm39) D2589E probably benign Het
E2f7 T C 10: 110,599,991 (GRCm39) Y249H not run Het
Eef2kmt T C 16: 5,068,373 (GRCm39) Y69C possibly damaging Het
Elapor1 T A 3: 108,371,619 (GRCm39) K650* probably null Het
Erlin1 T C 19: 44,047,504 (GRCm39) Y139C probably damaging Het
Exog G T 9: 119,291,544 (GRCm39) V274L possibly damaging Het
Fam83e G A 7: 45,371,896 (GRCm39) V98M probably benign Het
Fras1 C T 5: 96,857,745 (GRCm39) T2013I probably benign Het
Gart G T 16: 91,418,569 (GRCm39) A970E probably benign Het
Gga2 T A 7: 121,601,326 (GRCm39) H259L probably benign Het
Glis3 C A 19: 28,508,998 (GRCm39) V329F probably damaging Het
Gm6356 T A 14: 6,972,923 (GRCm38) N53I probably damaging Het
Golgb1 C A 16: 36,736,313 (GRCm39) C1894* probably null Het
Ifi203 T C 1: 173,756,733 (GRCm39) N350S unknown Het
Isy1 T A 6: 87,810,688 (GRCm39) R55S unknown Het
Itsn1 A T 16: 91,636,587 (GRCm39) D678V unknown Het
Lhcgr T A 17: 89,049,506 (GRCm39) R673S probably benign Het
Lnx2 C A 5: 146,956,943 (GRCm39) R601L possibly damaging Het
Map4 A G 9: 109,910,585 (GRCm39) T1093A probably benign Het
Minar1 A G 9: 89,483,679 (GRCm39) S573P probably benign Het
Mink1 A G 11: 70,489,899 (GRCm39) K92E probably benign Het
Moxd1 A G 10: 24,177,363 (GRCm39) I560V probably benign Het
Mrc2 C A 11: 105,220,061 (GRCm39) D327E possibly damaging Het
Notch2 A G 3: 98,038,643 (GRCm39) E1262G possibly damaging Het
Or2g1 T A 17: 38,107,248 (GRCm39) N304K probably benign Het
Or4k48 A G 2: 111,476,297 (GRCm39) L15S probably benign Het
Or52d3 C A 7: 104,229,645 (GRCm39) S264* probably null Het
Or5an1 G A 19: 12,261,180 (GRCm39) G256D possibly damaging Het
Or5b120 T A 19: 13,480,544 (GRCm39) M279K possibly damaging Het
Or5j3 GTACTTTTT GT 2: 86,128,338 (GRCm39) probably null Het
Or5m13 A T 2: 85,748,718 (GRCm39) I150F probably benign Het
Or6c5b A T 10: 129,245,654 (GRCm39) T140S possibly damaging Het
Pcbp2 T A 15: 102,381,782 (GRCm39) V5E probably damaging Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pgghg A T 7: 140,522,953 (GRCm39) Y104F probably benign Het
Plscr2 T C 9: 92,173,193 (GRCm39) probably null Het
Ppfibp1 C T 6: 146,879,551 (GRCm39) A25V probably damaging Het
Ptgfr C T 3: 151,541,034 (GRCm39) G158D probably benign Het
Ptgs2 T C 1: 149,978,446 (GRCm39) F186S probably damaging Het
Ptpn14 A G 1: 189,564,956 (GRCm39) E181G probably benign Het
Rpgrip1 A G 14: 52,368,673 (GRCm39) K291E possibly damaging Het
Rtn4rl1 T C 11: 75,085,122 (GRCm39) probably null Het
Sema3b T A 9: 107,478,141 (GRCm39) M415L probably benign Het
Sh3bp4 A G 1: 89,073,216 (GRCm39) E688G probably damaging Het
Slco6c1 G A 1: 97,055,887 (GRCm39) R5C possibly damaging Het
Slmap A G 14: 26,181,227 (GRCm39) F369L possibly damaging Het
Sphk2 T C 7: 45,361,894 (GRCm39) N181S possibly damaging Het
Sqor A G 2: 122,641,730 (GRCm39) T235A probably benign Het
St13 A G 15: 81,273,854 (GRCm39) L80P probably damaging Het
St3gal6 A G 16: 58,314,074 (GRCm39) Y20H probably benign Het
Sun1 T G 5: 139,234,239 (GRCm39) Y899D probably damaging Het
Synm C T 7: 67,385,128 (GRCm39) E845K possibly damaging Het
Tg A T 15: 66,566,633 (GRCm39) D1227V possibly damaging Het
Thbs1 A G 2: 117,945,438 (GRCm39) N306D possibly damaging Het
Tmcc3 A T 10: 94,414,357 (GRCm39) N51Y possibly damaging Het
Usp4 A G 9: 108,265,505 (GRCm39) D856G probably benign Het
Vil1 G A 1: 74,457,603 (GRCm39) A79T probably damaging Het
Vmn1r119 T A 7: 20,746,271 (GRCm39) H37L probably damaging Het
Vmn2r110 A T 17: 20,816,316 (GRCm39) M69K probably benign Het
Ywhaq A G 12: 21,444,982 (GRCm39) L221P probably damaging Het
Zfp142 G A 1: 74,609,167 (GRCm39) Q1543* probably null Het
Zfp384 T A 6: 125,001,793 (GRCm39) M146K possibly damaging Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7,290,672 (GRCm39) missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7,297,035 (GRCm39) missense probably benign 0.01
IGL01650:Clcn4 APN 7 7,287,280 (GRCm39) splice site probably benign
IGL02404:Clcn4 APN 7 7,290,857 (GRCm39) missense probably benign 0.04
IGL02493:Clcn4 APN 7 7,287,243 (GRCm39) missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7,299,065 (GRCm39) missense probably benign
IGL02661:Clcn4 APN 7 7,294,730 (GRCm39) splice site probably null
IGL02816:Clcn4 APN 7 7,298,087 (GRCm39) missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7,293,464 (GRCm39) missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7,293,419 (GRCm39) missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7,287,257 (GRCm39) missense probably damaging 1.00
Delipidated UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7,298,090 (GRCm39) nonsense probably null
R0379:Clcn4 UTSW 7 7,299,791 (GRCm39) missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7,293,503 (GRCm39) missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7,291,964 (GRCm39) missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7,299,763 (GRCm39) nonsense probably null
R1549:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7,296,981 (GRCm39) missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7,287,184 (GRCm39) makesense probably null
R2764:Clcn4 UTSW 7 7,299,798 (GRCm39) missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7,293,520 (GRCm39) missense probably benign 0.33
R4023:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7,297,833 (GRCm39) missense probably benign 0.02
R4154:Clcn4 UTSW 7 7,297,833 (GRCm39) missense probably benign 0.02
R4298:Clcn4 UTSW 7 7,299,737 (GRCm39) missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7,290,813 (GRCm39) missense probably benign 0.01
R4574:Clcn4 UTSW 7 7,290,804 (GRCm39) missense probably benign 0.23
R4977:Clcn4 UTSW 7 7,294,436 (GRCm39) missense probably benign 0.00
R5158:Clcn4 UTSW 7 7,294,618 (GRCm39) missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7,297,050 (GRCm39) missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7,299,032 (GRCm39) missense probably benign 0.26
R5624:Clcn4 UTSW 7 7,291,943 (GRCm39) missense probably benign 0.35
R5626:Clcn4 UTSW 7 7,292,017 (GRCm39) missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7,294,481 (GRCm39) missense probably benign 0.00
R6259:Clcn4 UTSW 7 7,294,529 (GRCm39) missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7,297,024 (GRCm39) missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7,302,181 (GRCm39) unclassified probably benign
R7562:Clcn4 UTSW 7 7,298,081 (GRCm39) missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7,296,958 (GRCm39) missense probably benign 0.00
R7752:Clcn4 UTSW 7 7,296,936 (GRCm39) missense probably benign
R7860:Clcn4 UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7,290,780 (GRCm39) missense probably benign
R7895:Clcn4 UTSW 7 7,298,167 (GRCm39) missense probably benign 0.26
R8069:Clcn4 UTSW 7 7,299,758 (GRCm39) missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7,294,427 (GRCm39) missense possibly damaging 0.69
R9185:Clcn4 UTSW 7 7,287,197 (GRCm39) missense possibly damaging 0.74
R9281:Clcn4 UTSW 7 7,294,813 (GRCm39) missense probably benign 0.16
R9333:Clcn4 UTSW 7 7,292,192 (GRCm39) missense probably damaging 1.00
R9682:Clcn4 UTSW 7 7,299,797 (GRCm39) missense probably benign 0.02
X0019:Clcn4 UTSW 7 7,294,609 (GRCm39) missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7,297,755 (GRCm39) missense probably damaging 0.96
Z1177:Clcn4 UTSW 7 7,296,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATCGTTGAAGAGCTCAGAGATG -3'
(R):5'- CCAAGGGAAAGGCTCTAAGC -3'

Sequencing Primer
(F):5'- CTCAGAGATGAGCTCACTGGTG -3'
(R):5'- ACCTTGTGGAGGTCATTC -3'
Posted On 2019-06-26