Incidental Mutation 'R0638:Efl1'
ID 56814
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 038827-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R0638 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82301095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 33 (T33I)
Ref Sequence ENSEMBL: ENSMUSP00000146350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000056728] [ENSMUST00000126478] [ENSMUST00000141726] [ENSMUST00000179489] [ENSMUST00000207693] [ENSMUST00000207868]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: T33I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056728
SMART Domains Protein: ENSMUSP00000057993
Gene: ENSMUSG00000038570

DomainStartEndE-ValueType
Pfam:STOP 4 201 3.6e-42 PFAM
Pfam:STOP 237 390 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably benign
Transcript: ENSMUST00000126478
Predicted Effect probably damaging
Transcript: ENSMUST00000141726
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563
AA Change: T33I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156720
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: T33I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207693
Predicted Effect probably damaging
Transcript: ENSMUST00000207868
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7694 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,547,572 (GRCm39) Q161K probably benign Het
Aatk A T 11: 119,900,748 (GRCm39) L1216Q probably damaging Het
Aifm3 T C 16: 17,321,535 (GRCm39) F463L possibly damaging Het
Antxr2 C T 5: 98,108,496 (GRCm39) W338* probably null Het
Apc2 T C 10: 80,140,801 (GRCm39) S219P probably damaging Het
Arfgap3 A T 15: 83,192,389 (GRCm39) probably null Het
Arrdc5 A G 17: 56,607,020 (GRCm39) V75A possibly damaging Het
Atg16l2 A T 7: 100,949,317 (GRCm39) probably null Het
Cacna1i A G 15: 80,265,281 (GRCm39) N1511S possibly damaging Het
Cad T C 5: 31,235,032 (GRCm39) Y2095H probably damaging Het
Chia1 T C 3: 106,035,753 (GRCm39) probably benign Het
Crybg2 A G 4: 133,801,765 (GRCm39) D975G probably damaging Het
Dagla T C 19: 10,232,247 (GRCm39) I480V probably damaging Het
Esp36 A G 17: 38,728,060 (GRCm39) F74L probably benign Het
Faim T C 9: 98,874,149 (GRCm39) probably benign Het
Fam83h G T 15: 75,875,776 (GRCm39) H520Q probably benign Het
Fbn2 A T 18: 58,178,446 (GRCm39) C1931S probably damaging Het
Frs3 A G 17: 48,012,581 (GRCm39) D96G probably benign Het
Gbp4 A G 5: 105,269,706 (GRCm39) M374T probably damaging Het
Gimap1 C T 6: 48,718,359 (GRCm39) probably benign Het
Gm10010 A G 6: 128,177,576 (GRCm39) noncoding transcript Het
Gm10355 T C 3: 101,214,214 (GRCm39) noncoding transcript Het
Gmip C T 8: 70,264,095 (GRCm39) probably benign Het
Gpc2 A T 5: 138,276,796 (GRCm39) F110Y possibly damaging Het
Ifi44l C T 3: 151,468,396 (GRCm39) V45M probably benign Het
Il15 T C 8: 83,069,890 (GRCm39) E58G probably damaging Het
Kat2b T C 17: 53,951,771 (GRCm39) probably benign Het
Kcnh7 C A 2: 62,607,854 (GRCm39) V576L probably benign Het
Lrrc66 T A 5: 73,772,816 (GRCm39) probably benign Het
Mical1 A G 10: 41,358,235 (GRCm39) E416G probably benign Het
Mroh3 A G 1: 136,118,740 (GRCm39) Y526H probably damaging Het
Mtx2 T C 2: 74,699,634 (GRCm39) probably benign Het
Naip6 A T 13: 100,437,036 (GRCm39) Y496N probably benign Het
Nfyc A G 4: 120,626,081 (GRCm39) S73P probably benign Het
Or10v9 C T 19: 11,832,487 (GRCm39) V277M probably damaging Het
Or10v9 A C 19: 11,832,732 (GRCm39) V195G probably damaging Het
Or1e23 T A 11: 73,407,750 (GRCm39) I92F probably damaging Het
Or5ak25 A G 2: 85,268,845 (GRCm39) I219T probably benign Het
Or6c69b T A 10: 129,627,101 (GRCm39) D119V probably damaging Het
P2ry14 A G 3: 59,022,869 (GRCm39) V206A probably benign Het
Polg G A 7: 79,109,896 (GRCm39) probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Ptgs1 G A 2: 36,130,868 (GRCm39) probably benign Het
Pus7l A G 15: 94,421,298 (GRCm39) S671P probably benign Het
Ralgapa2 T C 2: 146,184,112 (GRCm39) T1547A probably benign Het
Rif1 T C 2: 52,001,600 (GRCm39) S1685P probably benign Het
Rnf213 T C 11: 119,361,036 (GRCm39) Y4452H probably damaging Het
Samd7 A G 3: 30,810,670 (GRCm39) D229G probably benign Het
Serpina3j T C 12: 104,281,078 (GRCm39) S84P possibly damaging Het
Slc35d1 A G 4: 103,070,441 (GRCm39) probably benign Het
Sorbs2 A G 8: 46,249,347 (GRCm39) D847G probably damaging Het
Sp110 A C 1: 85,505,050 (GRCm39) F434C probably benign Het
Steap4 T C 5: 8,027,030 (GRCm39) probably benign Het
Tg A C 15: 66,589,057 (GRCm39) T13P probably damaging Het
Timeless T A 10: 128,080,542 (GRCm39) Y474* probably null Het
Tmem94 T C 11: 115,682,886 (GRCm39) probably null Het
Trdmt1 G A 2: 13,521,459 (GRCm39) probably benign Het
Trim23 T C 13: 104,337,817 (GRCm39) Y522H probably benign Het
Ttc13 A T 8: 125,401,105 (GRCm39) S624T probably damaging Het
Txnl1 A G 18: 63,825,135 (GRCm39) probably benign Het
Unkl T C 17: 25,427,057 (GRCm39) probably benign Het
Usp54 T A 14: 20,639,437 (GRCm39) probably benign Het
Vcam1 T C 3: 115,910,908 (GRCm39) K497E possibly damaging Het
Vmn1r49 C A 6: 90,049,648 (GRCm39) S118I possibly damaging Het
Vmn2r118 T C 17: 55,915,466 (GRCm39) K495E probably benign Het
Wrnip1 G A 13: 33,005,073 (GRCm39) C560Y possibly damaging Het
Xkr5 T C 8: 18,983,563 (GRCm39) R660G probably benign Het
Zfp280c A G X: 47,637,580 (GRCm39) probably benign Het
Zfp707 G A 15: 75,846,978 (GRCm39) A291T possibly damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGTCAGCCAGGGTCACACAC -3'
(R):5'- TGAAGACTTGCGATCATGGAACAGC -3'

Sequencing Primer
(F):5'- TGATGGTTTACCCAGAATGCC -3'
(R):5'- CGCAATATGGAAGTGAGCTTTTCTC -3'
Posted On 2013-07-11