Incidental Mutation 'R0638:Efl1'
ID56814
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R0638 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82651887 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 33 (T33I)
Ref Sequence ENSEMBL: ENSMUSP00000146350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000056728] [ENSMUST00000126478] [ENSMUST00000141726] [ENSMUST00000179489] [ENSMUST00000207693] [ENSMUST00000207868]
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: T33I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056728
SMART Domains Protein: ENSMUSP00000057993
Gene: ENSMUSG00000038570

DomainStartEndE-ValueType
Pfam:STOP 4 201 3.6e-42 PFAM
Pfam:STOP 237 390 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably benign
Transcript: ENSMUST00000126478
Predicted Effect probably damaging
Transcript: ENSMUST00000141726
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563
AA Change: T33I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156720
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: T33I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207693
Predicted Effect probably damaging
Transcript: ENSMUST00000207868
AA Change: T33I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7694 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGTCAGCCAGGGTCACACAC -3'
(R):5'- TGAAGACTTGCGATCATGGAACAGC -3'

Sequencing Primer
(F):5'- TGATGGTTTACCCAGAATGCC -3'
(R):5'- CGCAATATGGAAGTGAGCTTTTCTC -3'
Posted On2013-07-11