Incidental Mutation 'R0638:Atg16l2'
ID56815
Institutional Source Beutler Lab
Gene Symbol Atg16l2
Ensembl Gene ENSMUSG00000047767
Gene Nameautophagy related 16-like 2 (S. cerevisiae)
Synonyms2410118P20Rik
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0638 (G1)
Quality Score128
Status Validated
Chromosome7
Chromosomal Location101263034-101302251 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 101300110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120267] [ENSMUST00000120267] [ENSMUST00000122116] [ENSMUST00000122116] [ENSMUST00000139609] [ENSMUST00000139609] [ENSMUST00000140553] [ENSMUST00000140553] [ENSMUST00000143630] [ENSMUST00000143630] [ENSMUST00000207121] [ENSMUST00000207121]
Predicted Effect probably null
Transcript: ENSMUST00000120267
SMART Domains Protein: ENSMUSP00000112500
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 20 211 2.3e-36 PFAM
WD40 329 368 1.13e-7 SMART
WD40 373 412 6.79e-2 SMART
WD40 415 454 1.08e-4 SMART
WD40 457 493 2.97e0 SMART
WD40 496 534 1.61e-3 SMART
WD40 539 580 1.66e0 SMART
WD40 583 623 2.8e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120267
SMART Domains Protein: ENSMUSP00000112500
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 20 211 2.3e-36 PFAM
WD40 329 368 1.13e-7 SMART
WD40 373 412 6.79e-2 SMART
WD40 415 454 1.08e-4 SMART
WD40 457 493 2.97e0 SMART
WD40 496 534 1.61e-3 SMART
WD40 539 580 1.66e0 SMART
WD40 583 623 2.8e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122116
SMART Domains Protein: ENSMUSP00000113320
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 5.4e-14 PFAM
WD40 308 347 1.13e-7 SMART
WD40 352 391 6.79e-2 SMART
WD40 394 433 1.08e-4 SMART
WD40 436 472 2.97e0 SMART
WD40 475 513 1.61e-3 SMART
WD40 518 559 1.66e0 SMART
WD40 562 602 2.8e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122116
SMART Domains Protein: ENSMUSP00000113320
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 5.4e-14 PFAM
WD40 308 347 1.13e-7 SMART
WD40 352 391 6.79e-2 SMART
WD40 394 433 1.08e-4 SMART
WD40 436 472 2.97e0 SMART
WD40 475 513 1.61e-3 SMART
WD40 518 559 1.66e0 SMART
WD40 562 602 2.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123835
Predicted Effect probably benign
Transcript: ENSMUST00000139609
SMART Domains Protein: ENSMUSP00000117387
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139609
SMART Domains Protein: ENSMUSP00000117387
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140059
SMART Domains Protein: ENSMUSP00000119734
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
WD40 76 115 1.13e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140553
SMART Domains Protein: ENSMUSP00000116414
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140553
SMART Domains Protein: ENSMUSP00000116414
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143630
SMART Domains Protein: ENSMUSP00000117029
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143630
SMART Domains Protein: ENSMUSP00000117029
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151297
Predicted Effect probably benign
Transcript: ENSMUST00000207121
Predicted Effect probably benign
Transcript: ENSMUST00000207121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209093
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Atg16l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Atg16l2 APN 7 101300160 missense probably damaging 1.00
IGL00402:Atg16l2 APN 7 101296153 missense probably benign 0.00
IGL00662:Atg16l2 APN 7 101289896 missense probably benign 0.00
IGL00905:Atg16l2 APN 7 101300166 missense probably damaging 1.00
IGL01644:Atg16l2 APN 7 101297217 makesense probably null
IGL02839:Atg16l2 APN 7 101293397 missense probably damaging 1.00
R0316:Atg16l2 UTSW 7 101293396 missense probably damaging 1.00
R0683:Atg16l2 UTSW 7 101290384 missense probably damaging 1.00
R1436:Atg16l2 UTSW 7 101291550 missense probably damaging 1.00
R1592:Atg16l2 UTSW 7 101291986 missense probably damaging 1.00
R1623:Atg16l2 UTSW 7 101289906 missense probably benign 0.01
R2002:Atg16l2 UTSW 7 101294920 missense possibly damaging 0.62
R2090:Atg16l2 UTSW 7 101293368 splice site probably null
R2103:Atg16l2 UTSW 7 101290361 critical splice donor site probably null
R2349:Atg16l2 UTSW 7 101296539 missense probably damaging 0.96
R4738:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4739:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4740:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R5704:Atg16l2 UTSW 7 101300211 missense probably damaging 1.00
R6243:Atg16l2 UTSW 7 101292329 makesense probably null
R6257:Atg16l2 UTSW 7 101301895 splice site probably null
R6613:Atg16l2 UTSW 7 101290581 critical splice donor site probably null
R7331:Atg16l2 UTSW 7 101299048 missense probably damaging 1.00
R7349:Atg16l2 UTSW 7 101290266 missense probably damaging 1.00
R7719:Atg16l2 UTSW 7 101289867 missense probably damaging 1.00
R8186:Atg16l2 UTSW 7 101296507 critical splice donor site probably null
R8500:Atg16l2 UTSW 7 101290266 missense probably damaging 1.00
R8557:Atg16l2 UTSW 7 101290656 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TTAAGGTAAGCAGCCAGCTTGGGG -3'
(R):5'- GGAGGCCATACACAGGTGGTTTTG -3'

Sequencing Primer
(F):5'- CCAGCTTGGGGAGGACTC -3'
(R):5'- CCATCCCAGTATGAGGTAGCTTG -3'
Posted On2013-07-11