Incidental Mutation 'R7320:Abcc3'
ID 568159
Institutional Source Beutler Lab
Gene Symbol Abcc3
Ensembl Gene ENSMUSG00000020865
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Synonyms MRP3, 1700019L09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 94343295-94392997 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94367645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 458 (I458T)
Ref Sequence ENSEMBL: ENSMUSP00000136343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000178136]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021231
AA Change: I458T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: I458T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178136
AA Change: I458T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: I458T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Abcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Abcc3 APN 11 94343785 splice site probably benign
IGL01154:Abcc3 APN 11 94359232 splice site probably benign
IGL01353:Abcc3 APN 11 94352108 missense possibly damaging 0.88
IGL02553:Abcc3 APN 11 94351924 missense probably damaging 1.00
IGL02795:Abcc3 APN 11 94361642 splice site probably benign
IGL02928:Abcc3 APN 11 94361306 missense possibly damaging 0.49
IGL02964:Abcc3 APN 11 94351810 missense possibly damaging 0.93
IGL03006:Abcc3 APN 11 94368595 missense probably benign 0.18
IGL03345:Abcc3 APN 11 94359337 missense probably damaging 1.00
R0200:Abcc3 UTSW 11 94355074 missense probably damaging 0.96
R0377:Abcc3 UTSW 11 94375096 missense possibly damaging 0.90
R0812:Abcc3 UTSW 11 94375202 splice site probably benign
R1269:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1270:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1375:Abcc3 UTSW 11 94352216 missense possibly damaging 0.46
R1506:Abcc3 UTSW 11 94357318 missense possibly damaging 0.89
R1525:Abcc3 UTSW 11 94361236 missense probably benign 0.00
R1842:Abcc3 UTSW 11 94359612 missense probably benign 0.00
R1868:Abcc3 UTSW 11 94364063 missense probably benign 0.06
R2069:Abcc3 UTSW 11 94364417 missense probably damaging 1.00
R2132:Abcc3 UTSW 11 94367600 missense probably benign 0.18
R2257:Abcc3 UTSW 11 94363594 missense probably damaging 1.00
R2395:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R2930:Abcc3 UTSW 11 94361810 missense probably damaging 0.99
R3081:Abcc3 UTSW 11 94356976 missense probably damaging 1.00
R3824:Abcc3 UTSW 11 94368620 critical splice acceptor site probably null
R4385:Abcc3 UTSW 11 94368239 missense probably damaging 0.99
R4425:Abcc3 UTSW 11 94346044 missense probably damaging 0.98
R4464:Abcc3 UTSW 11 94358786 missense probably benign 0.01
R4696:Abcc3 UTSW 11 94350991 missense probably benign 0.01
R4877:Abcc3 UTSW 11 94367595 missense probably damaging 0.98
R5172:Abcc3 UTSW 11 94375608 missense probably damaging 1.00
R5586:Abcc3 UTSW 11 94364421 missense probably damaging 1.00
R5682:Abcc3 UTSW 11 94392897 missense probably benign 0.31
R5719:Abcc3 UTSW 11 94351068 missense probably damaging 1.00
R5816:Abcc3 UTSW 11 94343737 missense probably damaging 0.99
R5919:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R6222:Abcc3 UTSW 11 94368605 missense probably benign 0.21
R6264:Abcc3 UTSW 11 94373998 missense probably damaging 0.99
R6526:Abcc3 UTSW 11 94359372 missense probably benign 0.21
R6782:Abcc3 UTSW 11 94358950 missense probably damaging 1.00
R6889:Abcc3 UTSW 11 94375555 missense possibly damaging 0.49
R6953:Abcc3 UTSW 11 94374835 missense probably benign 0.03
R7054:Abcc3 UTSW 11 94365225 missense probably benign 0.01
R7131:Abcc3 UTSW 11 94365031 missense probably damaging 1.00
R7210:Abcc3 UTSW 11 94373941 missense probably benign 0.03
R7283:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7284:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7285:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7287:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7450:Abcc3 UTSW 11 94361695 missense probably damaging 1.00
R7469:Abcc3 UTSW 11 94368188 missense probably damaging 1.00
R7794:Abcc3 UTSW 11 94358871 missense probably benign 0.12
R7851:Abcc3 UTSW 11 94359660 nonsense probably null
R7861:Abcc3 UTSW 11 94357249 missense probably null 1.00
R8036:Abcc3 UTSW 11 94345992 missense possibly damaging 0.47
R8214:Abcc3 UTSW 11 94363518 missense probably damaging 0.96
R8447:Abcc3 UTSW 11 94364060 missense possibly damaging 0.49
R8558:Abcc3 UTSW 11 94351797 critical splice donor site probably null
R8733:Abcc3 UTSW 11 94358801 missense probably damaging 0.97
R8821:Abcc3 UTSW 11 94350961 missense probably damaging 1.00
R8831:Abcc3 UTSW 11 94350961 missense probably damaging 1.00
R9187:Abcc3 UTSW 11 94365087 missense probably damaging 1.00
R9315:Abcc3 UTSW 11 94374750 missense possibly damaging 0.72
X0064:Abcc3 UTSW 11 94363498 missense probably benign 0.00
Z1176:Abcc3 UTSW 11 94361275 missense probably benign 0.01
Z1177:Abcc3 UTSW 11 94357008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCCATTCAGTAGAGGGAG -3'
(R):5'- ATGCCAACACAACCAGTTTG -3'

Sequencing Primer
(F):5'- CCCATTCAGTAGAGGGAGTGGAG -3'
(R):5'- CTTCTCCAAGGGTGCTACTGG -3'
Posted On 2019-06-26