Mutagenetix > Incidental Mutations

Incidental Mutation 'R7320:Mrc2'

568161

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 105329235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 327 (D327E)

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

AlphaFold

Q64449

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021038
AA Change: D327E

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: D327E

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100335
AA Change: D327E

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: D327E

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,464,303	K650*	probably null	Het
Abcc3	A	G	11: 94,367,645	I458T	probably benign	Het
Adam29	A	G	8: 55,872,714	I235T	possibly damaging	Het
AF529169	A	G	9: 89,601,626	S573P	probably benign	Het
Afap1	G	A	5: 35,948,223	V174I	probably damaging	Het
Ak8	A	T	2: 28,812,992	D456V	probably damaging	Het
Alb	T	C	5: 90,464,987		probably null	Het
Alox12	C	T	11: 70,254,472	A92T	probably benign	Het
Arhgap23	T	C	11: 97,451,545	S218P	probably benign	Het
Blm	G	A	7: 80,455,354	Q1389*	probably null	Het
C1ql4	A	T	15: 99,087,724	V2E	unknown	Het
Casp12	A	G	9: 5,348,897		probably null	Het
Ccdc73	A	T	2: 104,999,176	I1065F	possibly damaging	Het
Ccdc83	C	T	7: 90,224,034	G371D	probably damaging	Het
Cfap65	A	G	1: 74,926,604	S416P	probably damaging	Het
Cftr	T	A	6: 18,319,013	C1351S	probably damaging	Het
Clcn4	A	T	7: 7,291,828	H311Q	probably benign	Het
Cldn13	T	G	5: 134,915,020	I104L	probably benign	Het
Cul9	A	G	17: 46,510,909	V1880A	possibly damaging	Het
Ddx17	A	T	15: 79,531,904	D407E	probably damaging	Het
Ddx28	G	A	8: 106,011,325	P34S	probably damaging	Het
Dnah5	A	T	15: 28,270,470	N973Y	probably null	Het
Dock10	A	G	1: 80,549,704		probably null	Het
Dock3	T	C	9: 106,895,524	D510G	probably benign	Het
Dst	T	A	1: 34,191,094	D2589E	probably benign	Het
E2f7	T	C	10: 110,764,130	Y249H	not run	Het
Eef2kmt	T	C	16: 5,250,509	Y69C	possibly damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Exog	G	T	9: 119,462,478	V274L	possibly damaging	Het
Fam83e	G	A	7: 45,722,472	V98M	probably benign	Het
Fras1	C	T	5: 96,709,886	T2013I	probably benign	Het
Gart	G	T	16: 91,621,681	A970E	probably benign	Het
Gga2	T	A	7: 122,002,103	H259L	probably benign	Het
Glis3	C	A	19: 28,531,598	V329F	probably damaging	Het
Gm6356	T	A	14: 6,972,923	N53I	probably damaging	Het
Golgb1	C	A	16: 36,915,951	C1894*	probably null	Het
Ifi203	T	C	1: 173,929,167	N350S	unknown	Het
Isy1	T	A	6: 87,833,706	R55S	unknown	Het
Itsn1	A	T	16: 91,839,699	D678V	unknown	Het
Lhcgr	T	A	17: 88,742,078	R673S	probably benign	Het
Lnx2	C	A	5: 147,020,133	R601L	possibly damaging	Het
Map4	A	G	9: 110,081,517	T1093A	probably benign	Het
Mink1	A	G	11: 70,599,073	K92E	probably benign	Het
Moxd1	A	G	10: 24,301,465	I560V	probably benign	Het
Notch2	A	G	3: 98,131,327	E1262G	possibly damaging	Het
Olfr1025-ps1	A	T	2: 85,918,374	I150F	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1298	A	G	2: 111,645,952	L15S	probably benign	Het
Olfr1434	G	A	19: 12,283,816	G256D	possibly damaging	Het
Olfr1477	T	A	19: 13,503,180	M279K	possibly damaging	Het
Olfr653	C	A	7: 104,580,438	S264*	probably null	Het
Olfr785	A	T	10: 129,409,785	T140S	possibly damaging	Het
Pcbp2	T	A	15: 102,473,347	V5E	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pgghg	A	T	7: 140,943,040	Y104F	probably benign	Het
Plscr2	T	C	9: 92,291,140		probably null	Het
Ppfibp1	C	T	6: 146,978,053	A25V	probably damaging	Het
Ptgfr	C	T	3: 151,835,397	G158D	probably benign	Het
Ptgs2	T	C	1: 150,102,695	F186S	probably damaging	Het
Ptpn14	A	G	1: 189,832,759	E181G	probably benign	Het
Rpgrip1	A	G	14: 52,131,216	K291E	possibly damaging	Het
Rtn4rl1	T	C	11: 75,194,296		probably null	Het
Sema3b	T	A	9: 107,600,942	M415L	probably benign	Het
Sh3bp4	A	G	1: 89,145,494	E688G	probably damaging	Het
Slco6c1	G	A	1: 97,128,162	R5C	possibly damaging	Het
Slmap	A	G	14: 26,460,072	F369L	possibly damaging	Het
Sphk2	T	C	7: 45,712,470	N181S	possibly damaging	Het
Sqor	A	G	2: 122,799,810	T235A	probably benign	Het
St13	A	G	15: 81,389,653	L80P	probably damaging	Het
St3gal6	A	G	16: 58,493,711	Y20H	probably benign	Het
Sun1	T	G	5: 139,248,484	Y899D	probably damaging	Het
Synm	C	T	7: 67,735,380	E845K	possibly damaging	Het
Tg	A	T	15: 66,694,784	D1227V	possibly damaging	Het
Thbs1	A	G	2: 118,114,957	N306D	possibly damaging	Het
Tmcc3	A	T	10: 94,578,495	N51Y	possibly damaging	Het
Usp4	A	G	9: 108,388,306	D856G	probably benign	Het
Vil1	G	A	1: 74,418,444	A79T	probably damaging	Het
Vmn1r119	T	A	7: 21,012,346	H37L	probably damaging	Het
Vmn2r110	A	T	17: 20,596,054	M69K	probably benign	Het
Wdr78	A	T	4: 103,050,187	I634N	possibly damaging	Het
Ywhaq	A	G	12: 21,394,981	L221P	probably damaging	Het
Zfp142	G	A	1: 74,570,008	Q1543*	probably null	Het
Zfp384	T	A	6: 125,024,830	M146K	possibly damaging	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7422:Mrc2	UTSW	11	105292783	start gained	probably benign
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105332266	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105348003	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105348355	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105343507	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105347306	missense	possibly damaging	0.62
R8771:Mrc2	UTSW	11	105349770	missense	probably benign
R8787:Mrc2	UTSW	11	105347639	missense	probably benign
R8925:Mrc2	UTSW	11	105325508	missense	probably benign	0.00
R8927:Mrc2	UTSW	11	105325508	missense	probably benign	0.00
R8991:Mrc2	UTSW	11	105338914	missense	probably benign
R9017:Mrc2	UTSW	11	105325885	missense	probably damaging	1.00
R9096:Mrc2	UTSW	11	105340572	missense	probably damaging	1.00
R9097:Mrc2	UTSW	11	105340572	missense	probably damaging	1.00
R9223:Mrc2	UTSW	11	105329267	missense	probably damaging	1.00
R9471:Mrc2	UTSW	11	105343733	missense	probably benign	0.03
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105341376	missense	possibly damaging	0.94
Z1176:Mrc2	UTSW	11	105347360	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTTAGGCACATAGATGCACCC -3'
(R):5'- GATCCTGATGTCCTTAGCCC -3'

Sequencing Primer
(F):5'- AGTTCAGTGTGGCATGACCCAG -3'
(R):5'- TAGCCCTTTGTGACCAGGC -3'

Posted On

2019-06-26