Incidental Mutation 'R7320:Or2g1'
ID 568178
Institutional Source Beutler Lab
Gene Symbol Or2g1
Ensembl Gene ENSMUSG00000045202
Gene Name olfactory receptor family 2 subfamily G member 1
Synonyms MOR256-9, GA_x6K02T2PSCP-2255106-2256035, Olfr123
MMRRC Submission 045370-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 38106337-38107266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38107248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 304 (N304K)
Ref Sequence ENSEMBL: ENSMUSP00000149802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054748] [ENSMUST00000214770] [ENSMUST00000215168] [ENSMUST00000216051] [ENSMUST00000216478] [ENSMUST00000217365]
AlphaFold Q8VFQ1
Predicted Effect probably benign
Transcript: ENSMUST00000054748
AA Change: N304K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058678
Gene: ENSMUSG00000045202
AA Change: N304K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 163 2.9e-6 PFAM
Pfam:7tm_4 29 306 2.3e-44 PFAM
Pfam:7TM_GPCR_Srsx 33 144 2.4e-5 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174446
Predicted Effect probably benign
Transcript: ENSMUST00000214770
AA Change: N304K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215168
Predicted Effect probably benign
Transcript: ENSMUST00000216051
AA Change: N304K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216478
Predicted Effect probably benign
Transcript: ENSMUST00000217365
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,258,471 (GRCm39) I458T probably benign Het
Adam29 A G 8: 56,325,749 (GRCm39) I235T possibly damaging Het
Afap1 G A 5: 36,105,567 (GRCm39) V174I probably damaging Het
Ak8 A T 2: 28,703,004 (GRCm39) D456V probably damaging Het
Alb T C 5: 90,612,846 (GRCm39) probably null Het
Alox12 C T 11: 70,145,298 (GRCm39) A92T probably benign Het
Arhgap23 T C 11: 97,342,371 (GRCm39) S218P probably benign Het
Blm G A 7: 80,105,102 (GRCm39) Q1389* probably null Het
C1ql4 A T 15: 98,985,605 (GRCm39) V2E unknown Het
Casp12 A G 9: 5,348,897 (GRCm39) probably null Het
Ccdc73 A T 2: 104,829,521 (GRCm39) I1065F possibly damaging Het
Ccdc83 C T 7: 89,873,242 (GRCm39) G371D probably damaging Het
Cfap65 A G 1: 74,965,763 (GRCm39) S416P probably damaging Het
Cftr T A 6: 18,319,012 (GRCm39) C1351S probably damaging Het
Clcn4 A T 7: 7,294,827 (GRCm39) H311Q probably benign Het
Cldn13 T G 5: 134,943,874 (GRCm39) I104L probably benign Het
Cul9 A G 17: 46,821,835 (GRCm39) V1880A possibly damaging Het
Ddx17 A T 15: 79,416,105 (GRCm39) D407E probably damaging Het
Ddx28 G A 8: 106,737,957 (GRCm39) P34S probably damaging Het
Dnah5 A T 15: 28,270,616 (GRCm39) N973Y probably null Het
Dnai4 A T 4: 102,907,384 (GRCm39) I634N possibly damaging Het
Dock10 A G 1: 80,527,421 (GRCm39) probably null Het
Dock3 T C 9: 106,772,723 (GRCm39) D510G probably benign Het
Dst T A 1: 34,230,175 (GRCm39) D2589E probably benign Het
E2f7 T C 10: 110,599,991 (GRCm39) Y249H not run Het
Eef2kmt T C 16: 5,068,373 (GRCm39) Y69C possibly damaging Het
Elapor1 T A 3: 108,371,619 (GRCm39) K650* probably null Het
Erlin1 T C 19: 44,047,504 (GRCm39) Y139C probably damaging Het
Exog G T 9: 119,291,544 (GRCm39) V274L possibly damaging Het
Fam83e G A 7: 45,371,896 (GRCm39) V98M probably benign Het
Fras1 C T 5: 96,857,745 (GRCm39) T2013I probably benign Het
Gart G T 16: 91,418,569 (GRCm39) A970E probably benign Het
Gga2 T A 7: 121,601,326 (GRCm39) H259L probably benign Het
Glis3 C A 19: 28,508,998 (GRCm39) V329F probably damaging Het
Gm6356 T A 14: 6,972,923 (GRCm38) N53I probably damaging Het
Golgb1 C A 16: 36,736,313 (GRCm39) C1894* probably null Het
Ifi203 T C 1: 173,756,733 (GRCm39) N350S unknown Het
Isy1 T A 6: 87,810,688 (GRCm39) R55S unknown Het
Itsn1 A T 16: 91,636,587 (GRCm39) D678V unknown Het
Lhcgr T A 17: 89,049,506 (GRCm39) R673S probably benign Het
Lnx2 C A 5: 146,956,943 (GRCm39) R601L possibly damaging Het
Map4 A G 9: 109,910,585 (GRCm39) T1093A probably benign Het
Minar1 A G 9: 89,483,679 (GRCm39) S573P probably benign Het
Mink1 A G 11: 70,489,899 (GRCm39) K92E probably benign Het
Moxd1 A G 10: 24,177,363 (GRCm39) I560V probably benign Het
Mrc2 C A 11: 105,220,061 (GRCm39) D327E possibly damaging Het
Notch2 A G 3: 98,038,643 (GRCm39) E1262G possibly damaging Het
Or4k48 A G 2: 111,476,297 (GRCm39) L15S probably benign Het
Or52d3 C A 7: 104,229,645 (GRCm39) S264* probably null Het
Or5an1 G A 19: 12,261,180 (GRCm39) G256D possibly damaging Het
Or5b120 T A 19: 13,480,544 (GRCm39) M279K possibly damaging Het
Or5j3 GTACTTTTT GT 2: 86,128,338 (GRCm39) probably null Het
Or5m13 A T 2: 85,748,718 (GRCm39) I150F probably benign Het
Or6c5b A T 10: 129,245,654 (GRCm39) T140S possibly damaging Het
Pcbp2 T A 15: 102,381,782 (GRCm39) V5E probably damaging Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pgghg A T 7: 140,522,953 (GRCm39) Y104F probably benign Het
Plscr2 T C 9: 92,173,193 (GRCm39) probably null Het
Ppfibp1 C T 6: 146,879,551 (GRCm39) A25V probably damaging Het
Ptgfr C T 3: 151,541,034 (GRCm39) G158D probably benign Het
Ptgs2 T C 1: 149,978,446 (GRCm39) F186S probably damaging Het
Ptpn14 A G 1: 189,564,956 (GRCm39) E181G probably benign Het
Rpgrip1 A G 14: 52,368,673 (GRCm39) K291E possibly damaging Het
Rtn4rl1 T C 11: 75,085,122 (GRCm39) probably null Het
Sema3b T A 9: 107,478,141 (GRCm39) M415L probably benign Het
Sh3bp4 A G 1: 89,073,216 (GRCm39) E688G probably damaging Het
Slco6c1 G A 1: 97,055,887 (GRCm39) R5C possibly damaging Het
Slmap A G 14: 26,181,227 (GRCm39) F369L possibly damaging Het
Sphk2 T C 7: 45,361,894 (GRCm39) N181S possibly damaging Het
Sqor A G 2: 122,641,730 (GRCm39) T235A probably benign Het
St13 A G 15: 81,273,854 (GRCm39) L80P probably damaging Het
St3gal6 A G 16: 58,314,074 (GRCm39) Y20H probably benign Het
Sun1 T G 5: 139,234,239 (GRCm39) Y899D probably damaging Het
Synm C T 7: 67,385,128 (GRCm39) E845K possibly damaging Het
Tg A T 15: 66,566,633 (GRCm39) D1227V possibly damaging Het
Thbs1 A G 2: 117,945,438 (GRCm39) N306D possibly damaging Het
Tmcc3 A T 10: 94,414,357 (GRCm39) N51Y possibly damaging Het
Usp4 A G 9: 108,265,505 (GRCm39) D856G probably benign Het
Vil1 G A 1: 74,457,603 (GRCm39) A79T probably damaging Het
Vmn1r119 T A 7: 20,746,271 (GRCm39) H37L probably damaging Het
Vmn2r110 A T 17: 20,816,316 (GRCm39) M69K probably benign Het
Ywhaq A G 12: 21,444,982 (GRCm39) L221P probably damaging Het
Zfp142 G A 1: 74,609,167 (GRCm39) Q1543* probably null Het
Zfp384 T A 6: 125,001,793 (GRCm39) M146K possibly damaging Het
Other mutations in Or2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Or2g1 APN 17 38,106,413 (GRCm39) missense probably damaging 0.99
IGL03030:Or2g1 APN 17 38,107,162 (GRCm39) missense probably damaging 1.00
IGL03107:Or2g1 APN 17 38,106,679 (GRCm39) missense probably benign 0.01
R0329:Or2g1 UTSW 17 38,106,880 (GRCm39) missense probably benign 0.01
R0330:Or2g1 UTSW 17 38,106,880 (GRCm39) missense probably benign 0.01
R0524:Or2g1 UTSW 17 38,106,496 (GRCm39) nonsense probably null
R0581:Or2g1 UTSW 17 38,106,993 (GRCm39) missense probably damaging 1.00
R1288:Or2g1 UTSW 17 38,106,584 (GRCm39) missense probably damaging 0.98
R1897:Or2g1 UTSW 17 38,107,075 (GRCm39) missense probably benign 0.22
R3751:Or2g1 UTSW 17 38,107,123 (GRCm39) missense possibly damaging 0.95
R3753:Or2g1 UTSW 17 38,107,123 (GRCm39) missense possibly damaging 0.95
R3780:Or2g1 UTSW 17 38,106,895 (GRCm39) missense probably damaging 1.00
R3947:Or2g1 UTSW 17 38,107,006 (GRCm39) missense probably benign
R5925:Or2g1 UTSW 17 38,106,482 (GRCm39) missense probably benign 0.00
R5987:Or2g1 UTSW 17 38,107,248 (GRCm39) missense probably benign
R6369:Or2g1 UTSW 17 38,106,387 (GRCm39) missense probably benign 0.02
R6891:Or2g1 UTSW 17 38,106,395 (GRCm39) missense probably benign
R7997:Or2g1 UTSW 17 38,107,053 (GRCm39) nonsense probably null
R8153:Or2g1 UTSW 17 38,106,367 (GRCm39) missense probably benign 0.00
R8793:Or2g1 UTSW 17 38,107,255 (GRCm39) missense probably benign 0.21
R9348:Or2g1 UTSW 17 38,106,992 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTATGGGAGCATCACAGCC -3'
(R):5'- AGAAACAGAAGAGTCATGGACTTCC -3'

Sequencing Primer
(F):5'- TTTATGGGAGCATCACAGCCATCTAC -3'
(R):5'- CTTCCAGAGAAGTGGGGCAATATTG -3'
Posted On 2019-06-26