Mutagenetix > Incidental Mutation

Incidental Mutation 'R7320:Lhcgr'

568180

Institutional Source

Beutler Lab

Gene Symbol

Lhcgr

Ensembl Gene

ENSMUSG00000024107

Gene Name

luteinizing hormone/choriogonadotropin receptor

Synonyms

Lhr, LH-R, Gpcr19-rs1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88741549-88791976 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88742078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 673 (R673S)

Ref Sequence

ENSEMBL: ENSMUSP00000024916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024916]

AlphaFold

P30730

Predicted Effect

probably benign
Transcript: ENSMUST00000024916
AA Change: R673S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: R673S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	33	66	4.4e0	SMART
Pfam:LRR_5	155	273	2.9e-5	PFAM
Pfam:7tm_1	380	627	1.2e-29	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,464,303	K650*	probably null	Het
Abcc3	A	G	11: 94,367,645	I458T	probably benign	Het
Adam29	A	G	8: 55,872,714	I235T	possibly damaging	Het
AF529169	A	G	9: 89,601,626	S573P	probably benign	Het
Afap1	G	A	5: 35,948,223	V174I	probably damaging	Het
Ak8	A	T	2: 28,812,992	D456V	probably damaging	Het
Alb	T	C	5: 90,464,987		probably null	Het
Alox12	C	T	11: 70,254,472	A92T	probably benign	Het
Arhgap23	T	C	11: 97,451,545	S218P	probably benign	Het
Blm	G	A	7: 80,455,354	Q1389*	probably null	Het
C1ql4	A	T	15: 99,087,724	V2E	unknown	Het
Casp12	A	G	9: 5,348,897		probably null	Het
Ccdc73	A	T	2: 104,999,176	I1065F	possibly damaging	Het
Ccdc83	C	T	7: 90,224,034	G371D	probably damaging	Het
Cfap65	A	G	1: 74,926,604	S416P	probably damaging	Het
Cftr	T	A	6: 18,319,013	C1351S	probably damaging	Het
Clcn4	A	T	7: 7,291,828	H311Q	probably benign	Het
Cldn13	T	G	5: 134,915,020	I104L	probably benign	Het
Cul9	A	G	17: 46,510,909	V1880A	possibly damaging	Het
Ddx17	A	T	15: 79,531,904	D407E	probably damaging	Het
Ddx28	G	A	8: 106,011,325	P34S	probably damaging	Het
Dnah5	A	T	15: 28,270,470	N973Y	probably null	Het
Dock10	A	G	1: 80,549,704		probably null	Het
Dock3	T	C	9: 106,895,524	D510G	probably benign	Het
Dst	T	A	1: 34,191,094	D2589E	probably benign	Het
E2f7	T	C	10: 110,764,130	Y249H	not run	Het
Eef2kmt	T	C	16: 5,250,509	Y69C	possibly damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Exog	G	T	9: 119,462,478	V274L	possibly damaging	Het
Fam83e	G	A	7: 45,722,472	V98M	probably benign	Het
Fras1	C	T	5: 96,709,886	T2013I	probably benign	Het
Gart	G	T	16: 91,621,681	A970E	probably benign	Het
Gga2	T	A	7: 122,002,103	H259L	probably benign	Het
Glis3	C	A	19: 28,531,598	V329F	probably damaging	Het
Gm6356	T	A	14: 6,972,923	N53I	probably damaging	Het
Golgb1	C	A	16: 36,915,951	C1894*	probably null	Het
Ifi203	T	C	1: 173,929,167	N350S	unknown	Het
Isy1	T	A	6: 87,833,706	R55S	unknown	Het
Itsn1	A	T	16: 91,839,699	D678V	unknown	Het
Lnx2	C	A	5: 147,020,133	R601L	possibly damaging	Het
Map4	A	G	9: 110,081,517	T1093A	probably benign	Het
Mink1	A	G	11: 70,599,073	K92E	probably benign	Het
Moxd1	A	G	10: 24,301,465	I560V	probably benign	Het
Mrc2	C	A	11: 105,329,235	D327E	possibly damaging	Het
Notch2	A	G	3: 98,131,327	E1262G	possibly damaging	Het
Olfr1025-ps1	A	T	2: 85,918,374	I150F	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1298	A	G	2: 111,645,952	L15S	probably benign	Het
Olfr1434	G	A	19: 12,283,816	G256D	possibly damaging	Het
Olfr1477	T	A	19: 13,503,180	M279K	possibly damaging	Het
Olfr653	C	A	7: 104,580,438	S264*	probably null	Het
Olfr785	A	T	10: 129,409,785	T140S	possibly damaging	Het
Pcbp2	T	A	15: 102,473,347	V5E	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pgghg	A	T	7: 140,943,040	Y104F	probably benign	Het
Plscr2	T	C	9: 92,291,140		probably null	Het
Ppfibp1	C	T	6: 146,978,053	A25V	probably damaging	Het
Ptgfr	C	T	3: 151,835,397	G158D	probably benign	Het
Ptgs2	T	C	1: 150,102,695	F186S	probably damaging	Het
Ptpn14	A	G	1: 189,832,759	E181G	probably benign	Het
Rpgrip1	A	G	14: 52,131,216	K291E	possibly damaging	Het
Rtn4rl1	T	C	11: 75,194,296		probably null	Het
Sema3b	T	A	9: 107,600,942	M415L	probably benign	Het
Sh3bp4	A	G	1: 89,145,494	E688G	probably damaging	Het
Slco6c1	G	A	1: 97,128,162	R5C	possibly damaging	Het
Slmap	A	G	14: 26,460,072	F369L	possibly damaging	Het
Sphk2	T	C	7: 45,712,470	N181S	possibly damaging	Het
Sqor	A	G	2: 122,799,810	T235A	probably benign	Het
St13	A	G	15: 81,389,653	L80P	probably damaging	Het
St3gal6	A	G	16: 58,493,711	Y20H	probably benign	Het
Sun1	T	G	5: 139,248,484	Y899D	probably damaging	Het
Synm	C	T	7: 67,735,380	E845K	possibly damaging	Het
Tg	A	T	15: 66,694,784	D1227V	possibly damaging	Het
Thbs1	A	G	2: 118,114,957	N306D	possibly damaging	Het
Tmcc3	A	T	10: 94,578,495	N51Y	possibly damaging	Het
Usp4	A	G	9: 108,388,306	D856G	probably benign	Het
Vil1	G	A	1: 74,418,444	A79T	probably damaging	Het
Vmn1r119	T	A	7: 21,012,346	H37L	probably damaging	Het
Vmn2r110	A	T	17: 20,596,054	M69K	probably benign	Het
Wdr78	A	T	4: 103,050,187	I634N	possibly damaging	Het
Ywhaq	A	G	12: 21,394,981	L221P	probably damaging	Het
Zfp142	G	A	1: 74,570,008	Q1543*	probably null	Het
Zfp384	T	A	6: 125,024,830	M146K	possibly damaging	Het

Other mutations in Lhcgr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Lhcgr	APN	17	88742446	missense	probably benign
IGL00661:Lhcgr	APN	17	88750118	missense	probably benign
IGL00840:Lhcgr	APN	17	88753736	splice site	probably benign
IGL01434:Lhcgr	APN	17	88742437	missense	probably damaging	1.00
IGL01489:Lhcgr	APN	17	88764973	splice site	probably benign
IGL02077:Lhcgr	APN	17	88750130	missense	probably benign	0.06
IGL02533:Lhcgr	APN	17	88742410	missense	probably benign	0.00
IGL02948:Lhcgr	APN	17	88742622	missense	probably damaging	1.00
capybara	UTSW	17	88742586	nonsense	probably null
coro	UTSW	17	88742249	nonsense	probably null
nutria	UTSW	17	88742373	missense	probably damaging	1.00
R0101:Lhcgr	UTSW	17	88765170	missense	probably damaging	1.00
R0101:Lhcgr	UTSW	17	88765170	missense	probably damaging	1.00
R0556:Lhcgr	UTSW	17	88772063	missense	probably damaging	0.99
R1824:Lhcgr	UTSW	17	88750157	missense	probably benign	0.00
R1846:Lhcgr	UTSW	17	88765147	critical splice donor site	probably null
R1852:Lhcgr	UTSW	17	88765176	missense	probably damaging	0.99
R2352:Lhcgr	UTSW	17	88742299	missense	possibly damaging	0.52
R3147:Lhcgr	UTSW	17	88758343	missense	probably damaging	0.96
R3756:Lhcgr	UTSW	17	88753856	missense	possibly damaging	0.77
R4180:Lhcgr	UTSW	17	88742283	missense	probably damaging	1.00
R4540:Lhcgr	UTSW	17	88755608	missense	probably benign
R4688:Lhcgr	UTSW	17	88765152	missense	probably damaging	0.99
R4717:Lhcgr	UTSW	17	88742467	missense	probably benign	0.00
R4723:Lhcgr	UTSW	17	88742602	missense	probably benign	0.09
R4776:Lhcgr	UTSW	17	88742697	missense	probably damaging	1.00
R4903:Lhcgr	UTSW	17	88742361	missense	probably damaging	1.00
R5195:Lhcgr	UTSW	17	88742946	missense	probably damaging	1.00
R5231:Lhcgr	UTSW	17	88755611	missense	probably damaging	1.00
R5361:Lhcgr	UTSW	17	88742853	missense	probably damaging	1.00
R5683:Lhcgr	UTSW	17	88772019	missense	probably benign	0.00
R5758:Lhcgr	UTSW	17	88742548	missense	probably damaging	0.99
R5929:Lhcgr	UTSW	17	88743008	nonsense	probably null
R5987:Lhcgr	UTSW	17	88755578	missense	probably damaging	1.00
R6268:Lhcgr	UTSW	17	88742704	missense	probably damaging	1.00
R6477:Lhcgr	UTSW	17	88742373	missense	probably damaging	1.00
R6610:Lhcgr	UTSW	17	88769879	missense	possibly damaging	0.93
R7234:Lhcgr	UTSW	17	88791931	missense	possibly damaging	0.96
R7282:Lhcgr	UTSW	17	88758383	missense	probably benign
R7398:Lhcgr	UTSW	17	88772046	missense	probably benign	0.03
R7710:Lhcgr	UTSW	17	88742782	missense	probably damaging	1.00
R8034:Lhcgr	UTSW	17	88742356	missense	probably damaging	1.00
R8108:Lhcgr	UTSW	17	88742050	nonsense	probably null
R8150:Lhcgr	UTSW	17	88742249	nonsense	probably null
R8151:Lhcgr	UTSW	17	88742249	nonsense	probably null
R8236:Lhcgr	UTSW	17	88742586	nonsense	probably null
R8901:Lhcgr	UTSW	17	88755602	missense	probably damaging	1.00
R8916:Lhcgr	UTSW	17	88753742	critical splice donor site	probably null
R9632:Lhcgr	UTSW	17	88742104	missense	probably benign
R9716:Lhcgr	UTSW	17	88743018	missense	probably damaging	1.00
U24488:Lhcgr	UTSW	17	88772085	critical splice acceptor site	probably null
X0028:Lhcgr	UTSW	17	88742722	missense	probably damaging	1.00
Z1176:Lhcgr	UTSW	17	88742270	missense	probably damaging	1.00
Z1177:Lhcgr	UTSW	17	88753905	missense	probably benign	0.00
Z1177:Lhcgr	UTSW	17	88764981	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGTTTCAATTCACCTGAAGTGC -3'
(R):5'- ACTCAAAAGTTCTGCTGGTCC -3'

Sequencing Primer
(F):5'- TCAATTCACCTGAAGTGCTTAAAG -3'
(R):5'- CGAAGGCATTTCAGAGAG -3'

Posted On

2019-06-26