Incidental Mutation 'R7320:Erlin1'
ID568184
Institutional Source Beutler Lab
Gene Symbol Erlin1
Ensembl Gene ENSMUSG00000025198
Gene NameER lipid raft associated 1
Synonyms2810439N09Rik, Spfh1, Keo4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7320 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44034944-44069785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44059065 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 139 (Y139C)
Ref Sequence ENSEMBL: ENSMUSP00000131012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071698] [ENSMUST00000112028] [ENSMUST00000170801] [ENSMUST00000171952] [ENSMUST00000172041]
AlphaFold Q91X78
Predicted Effect probably damaging
Transcript: ENSMUST00000071698
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071618
Gene: ENSMUSG00000025198
AA Change: Y139C

DomainStartEndE-ValueType
PHB 23 189 1.26e-38 SMART
Blast:PHB 217 253 2e-12 BLAST
low complexity region 254 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112028
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107659
Gene: ENSMUSG00000025198
AA Change: Y139C

DomainStartEndE-ValueType
PHB 23 189 1.26e-38 SMART
Blast:PHB 217 253 2e-12 BLAST
low complexity region 254 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170801
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129684
Gene: ENSMUSG00000025198
AA Change: Y139C

DomainStartEndE-ValueType
PHB 23 189 1.26e-38 SMART
Blast:PHB 217 253 2e-12 BLAST
low complexity region 254 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171952
SMART Domains Protein: ENSMUSP00000127971
Gene: ENSMUSG00000025198

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Blast:PHB 24 66 3e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172041
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131012
Gene: ENSMUSG00000025198
AA Change: Y139C

DomainStartEndE-ValueType
PHB 23 158 8.76e-15 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000126271
Gene: ENSMUSG00000025198
AA Change: Y55C

DomainStartEndE-ValueType
Blast:PHB 14 59 4e-16 BLAST
Meta Mutation Damage Score 0.8696 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgfr C T 3: 151,835,397 G158D probably benign Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Erlin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Erlin1 APN 19 44069319 nonsense probably null
IGL00551:Erlin1 APN 19 44059146 missense probably damaging 1.00
IGL01975:Erlin1 APN 19 44036931 missense probably damaging 1.00
IGL02171:Erlin1 APN 19 44049116 splice site probably benign
IGL02525:Erlin1 APN 19 44039195 missense probably benign 0.04
IGL02669:Erlin1 APN 19 44039219 missense probably damaging 1.00
IGL02939:Erlin1 APN 19 44063052 missense probably damaging 1.00
R1598:Erlin1 UTSW 19 44047673 missense probably damaging 1.00
R1911:Erlin1 UTSW 19 44049122 missense probably damaging 0.99
R1914:Erlin1 UTSW 19 44059065 missense probably damaging 1.00
R1915:Erlin1 UTSW 19 44059065 missense probably damaging 1.00
R4153:Erlin1 UTSW 19 44067617 missense probably benign 0.11
R4584:Erlin1 UTSW 19 44069319 nonsense probably null
R4607:Erlin1 UTSW 19 44063035 missense probably damaging 1.00
R4633:Erlin1 UTSW 19 44040765 missense probably damaging 0.99
R4645:Erlin1 UTSW 19 44069320 missense probably damaging 0.99
R4652:Erlin1 UTSW 19 44040792 nonsense probably null
R6550:Erlin1 UTSW 19 44037163 splice site probably null
R8062:Erlin1 UTSW 19 44056159 missense probably benign 0.25
R8171:Erlin1 UTSW 19 44069329 missense probably benign
R8519:Erlin1 UTSW 19 44069602 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTCATTTTGTAATTCCTACCAAACT -3'
(R):5'- CTGAGTCTGAAGATAGTTGGGTC -3'

Sequencing Primer
(F):5'- CTGAAGATAGCTACAGTGTACTCGC -3'
(R):5'- ATAGTTGGGTCATTGTTGGGTGAAAC -3'
Posted On2019-06-26