Mutagenetix > Incidental Mutations

Incidental Mutation 'R7322:Brinp3'

568190

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R7322 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 146682688 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 117 (R117*)

Ref Sequence

ENSEMBL: ENSMUSP00000074201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]

Predicted Effect

probably null
Transcript: ENSMUST00000074622
AA Change: R117*

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: R117*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000132847
AA Change: R117*

SMART Domains

Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131
AA Change: R117*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Blast:MACPF	78	110	1e-16	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000166814
AA Change: R117*

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: R117*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	T	4: 53,067,151	V1352D	probably damaging	Het
Adam33	C	T	2: 131,053,694	C567Y	probably damaging	Het
Alppl2	C	A	1: 87,087,462	G422C	probably benign	Het
Ang	T	A	14: 51,101,411	I3K	unknown	Het
Ankrd10	A	T	8: 11,615,841	V253E	probably damaging	Het
Arhgef17	T	C	7: 100,877,797	I806V	probably benign	Het
Atp10b	T	C	11: 43,212,547	L586P	probably damaging	Het
Bdkrb1	T	C	12: 105,604,304	V43A	possibly damaging	Het
Brwd1	A	T	16: 96,066,119	M172K	probably damaging	Het
Bsn	G	A	9: 108,126,421	R262*	probably null	Het
Bst2	A	C	8: 71,537,207	L74R	probably damaging	Het
C1qa	T	C	4: 136,896,154	*246W	probably null	Het
Cadm2	G	A	16: 66,882,846	T42M	probably damaging	Het
Ccdc150	A	G	1: 54,259,966	T34A	probably benign	Het
Ccdc178	G	A	18: 22,105,549	T337M	probably benign	Het
Ccl8	T	C	11: 82,116,582	V81A	probably damaging	Het
Dgcr6	A	G	16: 18,070,907	T69A	unknown	Het
Dnah10	A	G	5: 124,821,269	D3762G	probably benign	Het
Eif3d	T	C	15: 77,961,676	T382A	probably benign	Het
Epb41	A	T	4: 131,989,719	Y375N	probably damaging	Het
Epb41l1	A	T	2: 156,503,851	H258L	probably damaging	Het
Fbn1	A	C	2: 125,479,195	I81S	possibly damaging	Het
Fzd5	A	G	1: 64,735,328	S425P	probably damaging	Het
Gfra2	T	A	14: 70,968,391	V398D	probably benign	Het
Gm3755	A	G	14: 7,448,178	L130P		Het
Grin3b	A	G	10: 79,975,695	Y705C	probably damaging	Het
Hmcn2	A	G	2: 31,459,081	D4944G	probably damaging	Het
Hoxd11	T	C	2: 74,684,011	L295P	probably damaging	Het
Ighv1-81	C	A	12: 115,920,667	G16C	possibly damaging	Het
Kcna5	T	C	6: 126,533,791	D458G	possibly damaging	Het
Klb	A	T	5: 65,383,364	E933D	probably benign	Het
Lrp1	A	T	10: 127,545,564	M3855K	probably benign	Het
Map3k4	A	T	17: 12,270,946	L533I	probably damaging	Het
Mrps6	C	A	16: 92,058,447	Y4*	probably null	Het
Nabp1	A	T	1: 51,473,070	V105E	probably damaging	Het
Naip6	T	A	13: 100,299,388	N876Y	possibly damaging	Het
Nlrp2	T	C	7: 5,308,645	S944G	possibly damaging	Het
Nr4a3	A	T	4: 48,083,238	E590D	probably benign	Het
Olfr1054	C	T	2: 86,332,564	S264N	probably benign	Het
Olfr1106	A	T	2: 87,048,479	Y252*	probably null	Het
Olfr1564	A	G	17: 33,215,699	I215T	probably damaging	Het
Olfr362	T	C	2: 37,105,591	R20G	probably null	Het
Olfr597	T	A	7: 103,321,287	V292E		Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pdzd2	T	C	15: 12,437,162	D451G	probably damaging	Het
Pkd2l1	A	G	19: 44,157,690	S142P	probably benign	Het
Postn	T	C	3: 54,370,280	L232P	probably damaging	Het
Prss8	T	C	7: 127,929,563	T33A	probably benign	Het
Rapgef2	A	T	3: 79,145,823	M1K	probably null	Het
Rasa3	T	C	8: 13,595,857	N161S	possibly damaging	Het
Riox1	G	A	12: 83,950,668		probably benign	Het
Rmdn2	A	T	17: 79,621,611	K97N	probably damaging	Het
Sgo1	A	G	17: 53,677,057	L431P	probably damaging	Het
Slc9a8	T	A	2: 167,451,302	V217E	probably damaging	Het
Slco2b1	C	T	7: 99,691,848	G21D	not run	Het
Spata31d1d	C	A	13: 59,726,976	R915L	probably benign	Het
Stk17b	A	T	1: 53,765,945	N152K	probably benign	Het
Syne2	T	A	12: 75,984,024	I3634N	probably damaging	Het
Tnfrsf9	A	G	4: 150,934,337	D155G	probably damaging	Het
Tnrc6a	T	A	7: 123,171,508	D840E	probably benign	Het
Tyk2	G	A	9: 21,110,204	S902L	probably benign	Het
Unc119	T	C	11: 78,348,623	S235P	probably damaging	Het
Vav1	A	C	17: 57,302,266	D394A	probably benign	Het
Vezf1	T	A	11: 88,081,584	I439K	possibly damaging	Het
Zadh2	A	G	18: 84,095,135	Y312C	probably damaging	Het
Zfp335	A	T	2: 164,910,821	M1K	probably null	Het
Zfp715	T	C	7: 43,311,138	T10A	possibly damaging	Het
Zmynd11	C	T	13: 9,690,409	E382K	possibly damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGCAGTCATTATAATGAGGGATC -3'
(R):5'- AGGAGCATCTACAGTAGTGATATG -3'

Sequencing Primer
(F):5'- TGAGGGATCCAATTAACCTACCAAG -3'
(R):5'- GGATTAAATGCTCCTCTGCAGTGAC -3'

Posted On

2019-06-26