Incidental Mutation 'R7322:Olfr1054'
ID568195
Institutional Source Beutler Lab
Gene Symbol Olfr1054
Ensembl Gene ENSMUSG00000075190
Gene Nameolfactory receptor 1054
SynonymsGA_x6K02T2Q125-47811880-47810942, MOR188-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86332135-86335433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86332564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 264 (S264N)
Ref Sequence ENSEMBL: ENSMUSP00000150810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099895] [ENSMUST00000213205]
Predicted Effect probably benign
Transcript: ENSMUST00000099895
AA Change: S264N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097480
Gene: ENSMUSG00000075190
AA Change: S264N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-49 PFAM
Pfam:7tm_1 41 289 5.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213205
AA Change: S264N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Olfr1054
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr1054 APN 2 86332704 nonsense probably null
IGL02266:Olfr1054 APN 2 86332979 missense probably damaging 0.98
IGL02398:Olfr1054 APN 2 86332524 nonsense probably null
IGL02535:Olfr1054 APN 2 86332675 missense probably damaging 1.00
IGL02590:Olfr1054 APN 2 86333000 missense possibly damaging 0.52
IGL02630:Olfr1054 APN 2 86332868 missense probably benign 0.39
PIT4151001:Olfr1054 UTSW 2 86332829 missense possibly damaging 0.60
R0520:Olfr1054 UTSW 2 86333131 missense probably damaging 1.00
R1079:Olfr1054 UTSW 2 86332841 missense probably damaging 0.96
R1887:Olfr1054 UTSW 2 86333273 missense possibly damaging 0.90
R2037:Olfr1054 UTSW 2 86332430 missense probably benign 0.03
R2120:Olfr1054 UTSW 2 86333345 missense probably benign 0.00
R2153:Olfr1054 UTSW 2 86332528 missense probably damaging 1.00
R4523:Olfr1054 UTSW 2 86333300 missense probably benign 0.12
R4836:Olfr1054 UTSW 2 86333227 missense probably benign 0.12
R6147:Olfr1054 UTSW 2 86332500 missense probably damaging 1.00
R6802:Olfr1054 UTSW 2 86333185 missense possibly damaging 0.91
R6886:Olfr1054 UTSW 2 86333064 nonsense probably null
R6894:Olfr1054 UTSW 2 86332951 missense probably damaging 1.00
R7275:Olfr1054 UTSW 2 86332792 missense possibly damaging 0.91
R7325:Olfr1054 UTSW 2 86333000 missense possibly damaging 0.52
R7526:Olfr1054 UTSW 2 86333353 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGGTGCAAATTTTAAGAC -3'
(R):5'- AGTCATTTCTGCGATAGTCTCC -3'

Sequencing Primer
(F):5'- GTGGGTGCAAATTTTAAGACAATAG -3'
(R):5'- GCGATAGTCTCCCTTTAATATCATTG -3'
Posted On2019-06-26