Incidental Mutation 'R7322:Epb41'
ID 568206
Institutional Source Beutler Lab
Gene Symbol Epb41
Ensembl Gene ENSMUSG00000028906
Gene Name erythrocyte membrane protein band 4.1
Synonyms Epb4.1, 4.1R, D4Ertd442e, Elp1, Elp-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 131923413-132075321 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 131989719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 375 (Y375N)
Ref Sequence ENSEMBL: ENSMUSP00000081274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000105975] [ENSMUST00000105981] [ENSMUST00000137846] [ENSMUST00000141291]
AlphaFold P48193
Predicted Effect probably damaging
Transcript: ENSMUST00000030739
AA Change: Y375N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906
AA Change: Y375N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054917
AA Change: Y375N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906
AA Change: Y375N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084253
AA Change: Y375N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906
AA Change: Y375N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105970
AA Change: Y223N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906
AA Change: Y223N

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105972
AA Change: Y375N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906
AA Change: Y375N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105974
AA Change: Y340N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906
AA Change: Y340N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105975
AA Change: Y400N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906
AA Change: Y400N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105981
AA Change: Y375N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906
AA Change: Y375N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137846
AA Change: Y217N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906
AA Change: Y217N

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141291
AA Change: Y375N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120236
Gene: ENSMUSG00000028906
AA Change: Y375N

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 647 695 1.3e-29 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit moderate hemolytic anemia, erythrocytic abnormalities including aberrant morphology, reduced membrane stability, and lowered expression of spectrin and ankyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Epb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Epb41 APN 4 131974731 missense probably benign
IGL00897:Epb41 APN 4 132000197 splice site probably null
IGL00911:Epb41 APN 4 131989784 missense possibly damaging 0.60
IGL01390:Epb41 APN 4 132003737 missense probably benign
IGL01459:Epb41 APN 4 131964128 intron probably benign
IGL01816:Epb41 APN 4 132003695 missense probably benign 0.00
IGL02192:Epb41 APN 4 131929717 missense probably damaging 0.99
IGL02296:Epb41 APN 4 132003754 missense probably benign 0.42
IGL03011:Epb41 APN 4 132003794 missense probably damaging 1.00
IGL03268:Epb41 APN 4 131928495 missense probably damaging 1.00
IGL03388:Epb41 APN 4 131974794 missense probably damaging 1.00
R0355:Epb41 UTSW 4 132000261 missense probably damaging 0.99
R0532:Epb41 UTSW 4 131978795 splice site probably benign
R0550:Epb41 UTSW 4 131975613 missense probably damaging 1.00
R0571:Epb41 UTSW 4 131989904 missense probably damaging 1.00
R1158:Epb41 UTSW 4 132000191 splice site probably benign
R1444:Epb41 UTSW 4 132006071 missense probably benign
R2106:Epb41 UTSW 4 131989841 missense probably damaging 1.00
R2269:Epb41 UTSW 4 131964147 missense probably benign 0.09
R4014:Epb41 UTSW 4 131982445 splice site probably benign
R4017:Epb41 UTSW 4 131982445 splice site probably benign
R4952:Epb41 UTSW 4 132000270 missense probably damaging 0.99
R4976:Epb41 UTSW 4 131937436 unclassified probably benign
R5058:Epb41 UTSW 4 132007435 utr 5 prime probably benign
R5119:Epb41 UTSW 4 131937436 unclassified probably benign
R5229:Epb41 UTSW 4 131978935 missense probably damaging 1.00
R5571:Epb41 UTSW 4 131937406 unclassified probably benign
R6250:Epb41 UTSW 4 131989873 missense probably damaging 1.00
R6531:Epb41 UTSW 4 131957636 missense probably benign 0.00
R6890:Epb41 UTSW 4 131935829 missense probably damaging 0.98
R7265:Epb41 UTSW 4 131967834 missense unknown
R7289:Epb41 UTSW 4 131991209 critical splice donor site probably null
R7823:Epb41 UTSW 4 131974682 critical splice donor site probably null
R8296:Epb41 UTSW 4 131937461 missense
R8317:Epb41 UTSW 4 131957650 missense
R8401:Epb41 UTSW 4 131974707 missense probably damaging 1.00
R8880:Epb41 UTSW 4 131967793 missense
R9065:Epb41 UTSW 4 131955577 missense
R9414:Epb41 UTSW 4 131974851 missense probably damaging 1.00
R9682:Epb41 UTSW 4 131928509 missense
X0066:Epb41 UTSW 4 131974740 missense probably damaging 1.00
Z1177:Epb41 UTSW 4 132006083 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAATGACCATTACTCTGATGAC -3'
(R):5'- ACATTGTTGCTGGACGTCTG -3'

Sequencing Primer
(F):5'- CTGGAAGCAAAAACAAAAACAAAC -3'
(R):5'- TTGCTGGACGTCTGCCCTG -3'
Posted On 2019-06-26