Incidental Mutation 'R7322:Dnah10'
ID 568210
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Name dynein, axonemal, heavy chain 10
Synonyms Dnahc10
MMRRC Submission 045417-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 124802149-124911372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124898333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3762 (D3762G)
Ref Sequence ENSEMBL: ENSMUSP00000062995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: D3762G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: D3762G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: D3705G

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: D3705G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 (GRCm39) V1352D probably damaging Het
Adam33 C T 2: 130,895,614 (GRCm39) C567Y probably damaging Het
Alppl2 C A 1: 87,015,184 (GRCm39) G422C probably benign Het
Ang T A 14: 51,338,868 (GRCm39) I3K unknown Het
Ankrd10 A T 8: 11,665,841 (GRCm39) V253E probably damaging Het
Arhgef17 T C 7: 100,527,004 (GRCm39) I806V probably benign Het
Atp10b T C 11: 43,103,374 (GRCm39) L586P probably damaging Het
Bdkrb1 T C 12: 105,570,563 (GRCm39) V43A possibly damaging Het
Brinp3 C T 1: 146,558,426 (GRCm39) R117* probably null Het
Brwd1 A T 16: 95,867,319 (GRCm39) M172K probably damaging Het
Bsn G A 9: 108,003,620 (GRCm39) R262* probably null Het
Bst2 A C 8: 71,989,851 (GRCm39) L74R probably damaging Het
C1qa T C 4: 136,623,465 (GRCm39) *246W probably null Het
Cadm2 G A 16: 66,679,734 (GRCm39) T42M probably damaging Het
Ccdc150 A G 1: 54,299,125 (GRCm39) T34A probably benign Het
Ccdc178 G A 18: 22,238,606 (GRCm39) T337M probably benign Het
Ccl8 T C 11: 82,007,408 (GRCm39) V81A probably damaging Het
Dgcr6 A G 16: 17,888,771 (GRCm39) T69A unknown Het
Eif3d T C 15: 77,845,876 (GRCm39) T382A probably benign Het
Epb41 A T 4: 131,717,030 (GRCm39) Y375N probably damaging Het
Epb41l1 A T 2: 156,345,771 (GRCm39) H258L probably damaging Het
Fbn1 A C 2: 125,321,115 (GRCm39) I81S possibly damaging Het
Fzd5 A G 1: 64,774,487 (GRCm39) S425P probably damaging Het
Gfra2 T A 14: 71,205,831 (GRCm39) V398D probably benign Het
Gm3755 A G 14: 18,620,904 (GRCm39) L130P Het
Grin3b A G 10: 79,811,529 (GRCm39) Y705C probably damaging Het
Hmcn2 A G 2: 31,349,093 (GRCm39) D4944G probably damaging Het
Hoxd11 T C 2: 74,514,355 (GRCm39) L295P probably damaging Het
Ighv1-81 C A 12: 115,884,287 (GRCm39) G16C possibly damaging Het
Kcna5 T C 6: 126,510,754 (GRCm39) D458G possibly damaging Het
Klb A T 5: 65,540,707 (GRCm39) E933D probably benign Het
Lrp1 A T 10: 127,381,433 (GRCm39) M3855K probably benign Het
Map3k4 A T 17: 12,489,833 (GRCm39) L533I probably damaging Het
Mrps6 C A 16: 91,855,335 (GRCm39) Y4* probably null Het
Nabp1 A T 1: 51,512,229 (GRCm39) V105E probably damaging Het
Naip6 T A 13: 100,435,896 (GRCm39) N876Y possibly damaging Het
Nlrp2 T C 7: 5,311,644 (GRCm39) S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 (GRCm39) E590D probably benign Het
Or10h5 A G 17: 33,434,673 (GRCm39) I215T probably damaging Het
Or1b1 T C 2: 36,995,603 (GRCm39) R20G probably null Het
Or52ab2 T A 7: 102,970,494 (GRCm39) V292E Het
Or5j1 A T 2: 86,878,823 (GRCm39) Y252* probably null Het
Or8k22 C T 2: 86,162,908 (GRCm39) S264N probably benign Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pdzd2 T C 15: 12,437,248 (GRCm39) D451G probably damaging Het
Pkd2l1 A G 19: 44,146,129 (GRCm39) S142P probably benign Het
Postn T C 3: 54,277,701 (GRCm39) L232P probably damaging Het
Prss8 T C 7: 127,528,735 (GRCm39) T33A probably benign Het
Ptgr3 A G 18: 84,113,260 (GRCm39) Y312C probably damaging Het
Rapgef2 A T 3: 79,053,130 (GRCm39) M1K probably null Het
Rasa3 T C 8: 13,645,857 (GRCm39) N161S possibly damaging Het
Riox1 G A 12: 83,997,442 (GRCm39) probably benign Het
Rmdn2 A T 17: 79,929,040 (GRCm39) K97N probably damaging Het
Sgo1 A G 17: 53,984,085 (GRCm39) L431P probably damaging Het
Slc9a8 T A 2: 167,293,222 (GRCm39) V217E probably damaging Het
Slco2b1 C T 7: 99,341,055 (GRCm39) G21D not run Het
Spata31d1d C A 13: 59,874,790 (GRCm39) R915L probably benign Het
Stk17b A T 1: 53,805,104 (GRCm39) N152K probably benign Het
Syne2 T A 12: 76,030,798 (GRCm39) I3634N probably damaging Het
Tnfrsf9 A G 4: 151,018,794 (GRCm39) D155G probably damaging Het
Tnrc6a T A 7: 122,770,731 (GRCm39) D840E probably benign Het
Tyk2 G A 9: 21,021,500 (GRCm39) S902L probably benign Het
Unc119 T C 11: 78,239,449 (GRCm39) S235P probably damaging Het
Vav1 A C 17: 57,609,266 (GRCm39) D394A probably benign Het
Vezf1 T A 11: 87,972,410 (GRCm39) I439K possibly damaging Het
Zfp335 A T 2: 164,752,741 (GRCm39) M1K probably null Het
Zfp715 T C 7: 42,960,562 (GRCm39) T10A possibly damaging Het
Zmynd11 C T 13: 9,740,445 (GRCm39) E382K possibly damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124,905,667 (GRCm39) missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124,823,680 (GRCm39) missense probably benign 0.01
IGL00471:Dnah10 APN 5 124,871,405 (GRCm39) missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124,852,576 (GRCm39) missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124,854,276 (GRCm39) missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124,856,218 (GRCm39) missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124,861,010 (GRCm39) missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124,898,405 (GRCm39) missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124,809,553 (GRCm39) missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124,880,392 (GRCm39) missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124,864,529 (GRCm39) missense probably benign 0.10
IGL01757:Dnah10 APN 5 124,845,991 (GRCm39) missense probably benign 0.37
IGL01759:Dnah10 APN 5 124,832,850 (GRCm39) missense probably benign
IGL01767:Dnah10 APN 5 124,820,801 (GRCm39) splice site probably benign
IGL01769:Dnah10 APN 5 124,842,008 (GRCm39) missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124,860,985 (GRCm39) missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124,866,876 (GRCm39) missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124,881,810 (GRCm39) missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124,896,430 (GRCm39) missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124,910,487 (GRCm39) critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124,850,131 (GRCm39) missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124,850,883 (GRCm39) missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124,866,860 (GRCm39) missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124,870,916 (GRCm39) missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124,898,351 (GRCm39) missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124,864,395 (GRCm39) missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124,876,069 (GRCm39) missense probably benign 0.26
IGL02709:Dnah10 APN 5 124,850,809 (GRCm39) nonsense probably null
IGL02740:Dnah10 APN 5 124,903,927 (GRCm39) splice site probably benign
IGL02746:Dnah10 APN 5 124,807,150 (GRCm39) missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124,875,078 (GRCm39) missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124,878,886 (GRCm39) missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124,840,197 (GRCm39) missense probably benign 0.07
IGL03076:Dnah10 APN 5 124,807,226 (GRCm39) critical splice donor site probably null
IGL03109:Dnah10 APN 5 124,841,950 (GRCm39) missense probably benign 0.10
IGL03181:Dnah10 APN 5 124,825,521 (GRCm39) missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124,894,707 (GRCm39) missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124,894,761 (GRCm39) missense probably benign 0.00
IGL03328:Dnah10 APN 5 124,831,354 (GRCm39) missense probably benign 0.06
frosty UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124,906,593 (GRCm39) missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124,807,164 (GRCm39) missense probably benign
P0019:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
P0037:Dnah10 UTSW 5 124,895,056 (GRCm39) nonsense probably null
PIT4366001:Dnah10 UTSW 5 124,852,588 (GRCm39) missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124,803,966 (GRCm39) missense probably benign
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124,907,808 (GRCm39) missense probably benign 0.00
R0066:Dnah10 UTSW 5 124,840,140 (GRCm39) missense probably benign 0.01
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124,911,139 (GRCm39) missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124,873,433 (GRCm39) splice site probably benign
R0321:Dnah10 UTSW 5 124,900,416 (GRCm39) missense probably benign 0.29
R0410:Dnah10 UTSW 5 124,832,799 (GRCm39) missense probably benign
R0480:Dnah10 UTSW 5 124,885,915 (GRCm39) missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124,889,787 (GRCm39) critical splice donor site probably null
R0533:Dnah10 UTSW 5 124,852,314 (GRCm39) splice site probably null
R0599:Dnah10 UTSW 5 124,878,017 (GRCm39) missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124,827,876 (GRCm39) missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124,906,641 (GRCm39) missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124,875,002 (GRCm39) missense probably benign 0.00
R1203:Dnah10 UTSW 5 124,837,078 (GRCm39) splice site probably null
R1248:Dnah10 UTSW 5 124,832,887 (GRCm39) splice site probably benign
R1366:Dnah10 UTSW 5 124,830,390 (GRCm39) missense probably benign 0.41
R1434:Dnah10 UTSW 5 124,852,050 (GRCm39) missense probably benign 0.03
R1436:Dnah10 UTSW 5 124,839,285 (GRCm39) missense probably benign 0.00
R1438:Dnah10 UTSW 5 124,876,009 (GRCm39) missense probably benign 0.25
R1446:Dnah10 UTSW 5 124,866,860 (GRCm39) missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124,820,750 (GRCm39) missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1479:Dnah10 UTSW 5 124,854,953 (GRCm39) missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124,831,303 (GRCm39) missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124,838,016 (GRCm39) missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124,906,678 (GRCm39) missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124,842,626 (GRCm39) missense probably benign 0.00
R1709:Dnah10 UTSW 5 124,837,155 (GRCm39) missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124,850,254 (GRCm39) splice site probably null
R1828:Dnah10 UTSW 5 124,838,343 (GRCm39) missense probably benign 0.00
R1854:Dnah10 UTSW 5 124,881,753 (GRCm39) missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124,909,590 (GRCm39) splice site probably null
R1893:Dnah10 UTSW 5 124,831,381 (GRCm39) missense probably benign 0.13
R1895:Dnah10 UTSW 5 124,835,494 (GRCm39) missense probably benign 0.00
R1906:Dnah10 UTSW 5 124,878,048 (GRCm39) missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124,859,332 (GRCm39) missense probably benign 0.00
R1965:Dnah10 UTSW 5 124,852,267 (GRCm39) missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124,911,052 (GRCm39) missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124,906,651 (GRCm39) missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124,823,768 (GRCm39) missense probably benign 0.30
R2046:Dnah10 UTSW 5 124,873,405 (GRCm39) missense probably benign 0.25
R2074:Dnah10 UTSW 5 124,891,738 (GRCm39) missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124,852,045 (GRCm39) missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124,838,301 (GRCm39) missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124,808,530 (GRCm39) missense probably benign 0.00
R2293:Dnah10 UTSW 5 124,896,285 (GRCm39) missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124,819,064 (GRCm39) missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124,839,929 (GRCm39) critical splice donor site probably null
R2571:Dnah10 UTSW 5 124,852,542 (GRCm39) missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124,894,734 (GRCm39) missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124,896,476 (GRCm39) critical splice donor site probably null
R3439:Dnah10 UTSW 5 124,873,322 (GRCm39) missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124,824,694 (GRCm39) missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124,850,095 (GRCm39) missense probably benign 0.37
R4015:Dnah10 UTSW 5 124,854,990 (GRCm39) missense probably benign 0.25
R4261:Dnah10 UTSW 5 124,807,201 (GRCm39) missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124,809,394 (GRCm39) missense probably benign 0.28
R4299:Dnah10 UTSW 5 124,896,989 (GRCm39) missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124,839,933 (GRCm39) splice site probably null
R4651:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4652:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4664:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124,852,581 (GRCm39) missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124,824,809 (GRCm39) missense probably benign 0.01
R4806:Dnah10 UTSW 5 124,896,408 (GRCm39) missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124,850,196 (GRCm39) missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124,894,812 (GRCm39) missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124,839,260 (GRCm39) missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124,909,577 (GRCm39) missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5119:Dnah10 UTSW 5 124,856,322 (GRCm39) missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124,876,024 (GRCm39) missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124,864,484 (GRCm39) missense probably benign 0.00
R5262:Dnah10 UTSW 5 124,862,220 (GRCm39) missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124,868,851 (GRCm39) missense probably benign 0.01
R5322:Dnah10 UTSW 5 124,850,630 (GRCm39) missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124,820,693 (GRCm39) missense probably benign 0.16
R5468:Dnah10 UTSW 5 124,907,557 (GRCm39) missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124,830,232 (GRCm39) missense probably benign
R5587:Dnah10 UTSW 5 124,870,977 (GRCm39) missense probably benign 0.10
R5724:Dnah10 UTSW 5 124,819,090 (GRCm39) missense probably benign 0.27
R5797:Dnah10 UTSW 5 124,898,450 (GRCm39) missense probably benign 0.00
R5812:Dnah10 UTSW 5 124,824,810 (GRCm39) missense probably benign 0.01
R5846:Dnah10 UTSW 5 124,900,437 (GRCm39) missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R5961:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5970:Dnah10 UTSW 5 124,885,793 (GRCm39) missense probably benign
R6021:Dnah10 UTSW 5 124,814,048 (GRCm39) missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124,878,924 (GRCm39) missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124,896,274 (GRCm39) missense probably benign 0.09
R6080:Dnah10 UTSW 5 124,882,961 (GRCm39) missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124,830,238 (GRCm39) missense probably benign 0.18
R6155:Dnah10 UTSW 5 124,862,239 (GRCm39) missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124,847,663 (GRCm39) missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124,900,382 (GRCm39) missense probably benign 0.02
R6238:Dnah10 UTSW 5 124,820,743 (GRCm39) missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124,871,283 (GRCm39) splice site probably null
R6275:Dnah10 UTSW 5 124,862,248 (GRCm39) missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124,852,144 (GRCm39) missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124,906,710 (GRCm39) missense probably benign 0.00
R6458:Dnah10 UTSW 5 124,886,333 (GRCm39) missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124,839,846 (GRCm39) missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124,835,419 (GRCm39) missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124,907,097 (GRCm39) missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124,837,223 (GRCm39) missense probably benign 0.45
R6702:Dnah10 UTSW 5 124,882,869 (GRCm39) missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124,885,876 (GRCm39) missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124,854,890 (GRCm39) missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124,867,064 (GRCm39) splice site probably null
R6932:Dnah10 UTSW 5 124,898,514 (GRCm39) missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124,864,490 (GRCm39) missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124,893,206 (GRCm39) missense probably benign 0.37
R7138:Dnah10 UTSW 5 124,900,009 (GRCm39) missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124,900,006 (GRCm39) missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124,890,892 (GRCm39) missense probably benign 0.19
R7278:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R7284:Dnah10 UTSW 5 124,909,662 (GRCm39) missense probably benign 0.37
R7523:Dnah10 UTSW 5 124,824,803 (GRCm39) missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124,876,095 (GRCm39) missense probably damaging 1.00
R7593:Dnah10 UTSW 5 124,823,608 (GRCm39) missense probably benign 0.21
R7606:Dnah10 UTSW 5 124,894,776 (GRCm39) missense probably benign 0.00
R7835:Dnah10 UTSW 5 124,854,298 (GRCm39) missense probably damaging 1.00
R7898:Dnah10 UTSW 5 124,859,425 (GRCm39) missense probably damaging 1.00
R7972:Dnah10 UTSW 5 124,803,949 (GRCm39) missense probably benign
R7999:Dnah10 UTSW 5 124,802,322 (GRCm39) missense probably benign 0.06
R8017:Dnah10 UTSW 5 124,877,949 (GRCm39) missense probably benign 0.03
R8032:Dnah10 UTSW 5 124,823,676 (GRCm39) missense probably damaging 0.98
R8052:Dnah10 UTSW 5 124,905,575 (GRCm39) missense probably benign 0.00
R8088:Dnah10 UTSW 5 124,831,330 (GRCm39) missense probably benign 0.00
R8169:Dnah10 UTSW 5 124,877,946 (GRCm39) missense probably damaging 1.00
R8178:Dnah10 UTSW 5 124,832,790 (GRCm39) missense probably benign 0.11
R8200:Dnah10 UTSW 5 124,905,524 (GRCm39) missense probably damaging 1.00
R8210:Dnah10 UTSW 5 124,827,858 (GRCm39) missense probably benign 0.29
R8294:Dnah10 UTSW 5 124,859,410 (GRCm39) missense probably damaging 1.00
R8338:Dnah10 UTSW 5 124,909,566 (GRCm39) missense probably damaging 1.00
R8404:Dnah10 UTSW 5 124,850,606 (GRCm39) missense probably damaging 1.00
R8469:Dnah10 UTSW 5 124,813,895 (GRCm39) missense probably damaging 1.00
R8537:Dnah10 UTSW 5 124,893,164 (GRCm39) missense probably damaging 0.97
R8701:Dnah10 UTSW 5 124,803,911 (GRCm39) missense probably benign 0.00
R8723:Dnah10 UTSW 5 124,891,685 (GRCm39) missense probably damaging 0.99
R8770:Dnah10 UTSW 5 124,852,410 (GRCm39) missense possibly damaging 0.94
R8838:Dnah10 UTSW 5 124,842,614 (GRCm39) missense probably benign 0.09
R8879:Dnah10 UTSW 5 124,895,181 (GRCm39) missense probably damaging 1.00
R8928:Dnah10 UTSW 5 124,866,828 (GRCm39) missense probably damaging 0.98
R8932:Dnah10 UTSW 5 124,878,015 (GRCm39) missense possibly damaging 0.96
R8945:Dnah10 UTSW 5 124,891,006 (GRCm39) missense probably damaging 0.99
R8990:Dnah10 UTSW 5 124,814,057 (GRCm39) missense
R9001:Dnah10 UTSW 5 124,852,515 (GRCm39) missense probably damaging 1.00
R9006:Dnah10 UTSW 5 124,820,783 (GRCm39) missense probably benign 0.23
R9060:Dnah10 UTSW 5 124,905,141 (GRCm39) missense probably damaging 1.00
R9085:Dnah10 UTSW 5 124,839,237 (GRCm39) missense
R9133:Dnah10 UTSW 5 124,859,423 (GRCm39) missense probably damaging 1.00
R9155:Dnah10 UTSW 5 124,907,475 (GRCm39) missense probably damaging 0.99
R9220:Dnah10 UTSW 5 124,871,437 (GRCm39) missense probably benign 0.05
R9234:Dnah10 UTSW 5 124,818,989 (GRCm39) missense possibly damaging 0.94
R9264:Dnah10 UTSW 5 124,813,900 (GRCm39) missense probably damaging 1.00
R9266:Dnah10 UTSW 5 124,845,990 (GRCm39) missense probably benign 0.00
R9386:Dnah10 UTSW 5 124,871,507 (GRCm39) critical splice donor site probably null
R9446:Dnah10 UTSW 5 124,823,677 (GRCm39) missense probably damaging 1.00
R9484:Dnah10 UTSW 5 124,900,508 (GRCm39) missense probably damaging 1.00
R9594:Dnah10 UTSW 5 124,907,107 (GRCm39) missense probably damaging 1.00
R9691:Dnah10 UTSW 5 124,852,249 (GRCm39) missense probably damaging 0.98
RF015:Dnah10 UTSW 5 124,895,141 (GRCm39) missense probably damaging 1.00
RF021:Dnah10 UTSW 5 124,854,971 (GRCm39) missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
U24488:Dnah10 UTSW 5 124,891,044 (GRCm39) missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124,842,761 (GRCm39) missense probably benign 0.22
Z1176:Dnah10 UTSW 5 124,852,419 (GRCm39) missense probably benign 0.11
Z1177:Dnah10 UTSW 5 124,819,019 (GRCm39) missense probably damaging 1.00
Z1177:Dnah10 UTSW 5 124,895,052 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah10 UTSW 5 124,824,683 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCATGAAAGGACATGGCCTG -3'
(R):5'- CAGCCGCTTTAGAAGGATGG -3'

Sequencing Primer
(F):5'- CTCAAATTCAAGGTCTCTGCAGGG -3'
(R):5'- CCGCTTTAGAAGGATGGAGTCG -3'
Posted On 2019-06-26