Incidental Mutation 'R7322:Dnah10'
ID568210
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Namedynein, axonemal, heavy chain 10
SynonymsDnahc10
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location124725085-124834308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124821269 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 3762 (D3762G)
Ref Sequence ENSEMBL: ENSMUSP00000062995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: D3762G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: D3762G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: D3705G

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: D3705G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124828603 missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124746616 missense probably benign 0.01
IGL00471:Dnah10 APN 5 124794341 missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124775512 missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124777212 missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124779154 missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124783946 missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124821341 missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124732489 missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124803328 missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124787465 missense probably benign 0.10
IGL01757:Dnah10 APN 5 124768927 missense probably benign 0.37
IGL01759:Dnah10 APN 5 124755786 missense probably benign
IGL01767:Dnah10 APN 5 124743737 splice site probably benign
IGL01769:Dnah10 APN 5 124764944 missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124783921 missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124789812 missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124804746 missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124819366 missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124833423 critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124773067 missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124773819 missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124789796 missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124793852 missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124821287 missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124787331 missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124799005 missense probably benign 0.26
IGL02709:Dnah10 APN 5 124773745 nonsense probably null
IGL02740:Dnah10 APN 5 124826863 splice site probably benign
IGL02746:Dnah10 APN 5 124730086 missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124798014 missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124801822 missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124763133 missense probably benign 0.07
IGL03076:Dnah10 APN 5 124730162 critical splice donor site probably null
IGL03109:Dnah10 APN 5 124764886 missense probably benign 0.10
IGL03181:Dnah10 APN 5 124748457 missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124817643 missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124817697 missense probably benign 0.00
IGL03328:Dnah10 APN 5 124754290 missense probably benign 0.06
frosty UTSW 5 124828137 missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124829529 missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124730100 missense probably benign
P0019:Dnah10 UTSW 5 124763066 missense probably benign
P0037:Dnah10 UTSW 5 124817992 nonsense probably null
PIT4366001:Dnah10 UTSW 5 124775524 missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124726902 missense probably benign
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124830744 missense probably benign 0.00
R0066:Dnah10 UTSW 5 124763076 missense probably benign 0.01
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124834075 missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124796369 splice site probably benign
R0321:Dnah10 UTSW 5 124823352 missense probably benign 0.29
R0410:Dnah10 UTSW 5 124755735 missense probably benign
R0480:Dnah10 UTSW 5 124808851 missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124812723 critical splice donor site probably null
R0533:Dnah10 UTSW 5 124775250 splice site probably null
R0599:Dnah10 UTSW 5 124800953 missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124750812 missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124829577 missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124797938 missense probably benign 0.00
R1203:Dnah10 UTSW 5 124760014 splice site probably null
R1248:Dnah10 UTSW 5 124755823 splice site probably benign
R1366:Dnah10 UTSW 5 124753326 missense probably benign 0.41
R1434:Dnah10 UTSW 5 124774986 missense probably benign 0.03
R1436:Dnah10 UTSW 5 124762221 missense probably benign 0.00
R1438:Dnah10 UTSW 5 124798945 missense probably benign 0.25
R1446:Dnah10 UTSW 5 124789796 missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124743686 missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1479:Dnah10 UTSW 5 124777889 missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124754239 missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124760952 missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124829614 missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124765562 missense probably benign 0.00
R1709:Dnah10 UTSW 5 124760091 missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124773190 splice site probably null
R1828:Dnah10 UTSW 5 124761279 missense probably benign 0.00
R1854:Dnah10 UTSW 5 124804689 missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124832526 splice site probably null
R1893:Dnah10 UTSW 5 124754317 missense probably benign 0.13
R1895:Dnah10 UTSW 5 124758430 missense probably benign 0.00
R1906:Dnah10 UTSW 5 124800984 missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124782268 missense probably benign 0.00
R1965:Dnah10 UTSW 5 124775203 missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124833988 missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124829587 missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124746704 missense probably benign 0.30
R2046:Dnah10 UTSW 5 124796341 missense probably benign 0.25
R2074:Dnah10 UTSW 5 124814674 missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124774981 missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124761237 missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124731466 missense probably benign 0.00
R2293:Dnah10 UTSW 5 124819221 missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124742000 missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124762865 critical splice donor site probably null
R2571:Dnah10 UTSW 5 124775478 missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124817670 missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124819412 critical splice donor site probably null
R3439:Dnah10 UTSW 5 124796258 missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124747630 missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124773031 missense probably benign 0.37
R4015:Dnah10 UTSW 5 124777926 missense probably benign 0.25
R4261:Dnah10 UTSW 5 124730137 missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124732330 missense probably benign 0.28
R4299:Dnah10 UTSW 5 124819925 missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124762869 splice site probably null
R4651:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4652:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4664:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124775517 missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124747745 missense probably benign 0.01
R4806:Dnah10 UTSW 5 124819344 missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124773132 missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124817748 missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124762196 missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124832513 missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5119:Dnah10 UTSW 5 124779258 missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124798960 missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124787420 missense probably benign 0.00
R5262:Dnah10 UTSW 5 124785156 missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124828137 missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124791787 missense probably benign 0.01
R5322:Dnah10 UTSW 5 124773566 missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124743629 missense probably benign 0.16
R5468:Dnah10 UTSW 5 124830493 missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124753168 missense probably benign
R5587:Dnah10 UTSW 5 124793913 missense probably benign 0.10
R5724:Dnah10 UTSW 5 124742026 missense probably benign 0.27
R5797:Dnah10 UTSW 5 124821386 missense probably benign 0.00
R5812:Dnah10 UTSW 5 124747746 missense probably benign 0.01
R5846:Dnah10 UTSW 5 124823373 missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R5961:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5970:Dnah10 UTSW 5 124808729 missense probably benign
R6021:Dnah10 UTSW 5 124736984 missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124801860 missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124819210 missense probably benign 0.09
R6080:Dnah10 UTSW 5 124805897 missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124753174 missense probably benign 0.18
R6155:Dnah10 UTSW 5 124770599 missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124785175 missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124823318 missense probably benign 0.02
R6238:Dnah10 UTSW 5 124743679 missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124794219 splice site probably null
R6275:Dnah10 UTSW 5 124785184 missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124775080 missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124829646 missense probably benign 0.00
R6458:Dnah10 UTSW 5 124809269 missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124762782 missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124758355 missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124830033 missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124760159 missense probably benign 0.45
R6702:Dnah10 UTSW 5 124805805 missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124808812 missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124777826 missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124790000 splice site probably null
R6932:Dnah10 UTSW 5 124821450 missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124787426 missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124816142 missense probably benign 0.37
R7138:Dnah10 UTSW 5 124822945 missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124822942 missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124813828 missense probably benign 0.19
R7278:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R7284:Dnah10 UTSW 5 124832598 missense probably benign 0.37
R7523:Dnah10 UTSW 5 124747739 missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124799031 missense probably damaging 1.00
R7593:Dnah10 UTSW 5 124746544 missense probably benign 0.21
R7606:Dnah10 UTSW 5 124817712 missense probably benign 0.00
R7835:Dnah10 UTSW 5 124777234 missense probably damaging 1.00
R7898:Dnah10 UTSW 5 124782361 missense probably damaging 1.00
R7972:Dnah10 UTSW 5 124726885 missense probably benign
R7999:Dnah10 UTSW 5 124725258 missense probably benign 0.06
R8017:Dnah10 UTSW 5 124800885 missense probably benign 0.03
R8032:Dnah10 UTSW 5 124746612 missense probably damaging 0.98
R8052:Dnah10 UTSW 5 124828511 missense probably benign 0.00
R8088:Dnah10 UTSW 5 124754266 missense probably benign 0.00
R8169:Dnah10 UTSW 5 124800882 missense probably damaging 1.00
R8178:Dnah10 UTSW 5 124755726 missense probably benign 0.11
R8200:Dnah10 UTSW 5 124828460 missense probably damaging 1.00
R8210:Dnah10 UTSW 5 124750794 missense probably benign 0.29
R8294:Dnah10 UTSW 5 124782346 missense probably damaging 1.00
R8338:Dnah10 UTSW 5 124832502 missense probably damaging 1.00
R8404:Dnah10 UTSW 5 124773542 missense probably damaging 1.00
R8469:Dnah10 UTSW 5 124736831 missense probably damaging 1.00
R8537:Dnah10 UTSW 5 124816100 missense probably damaging 0.97
R8701:Dnah10 UTSW 5 124726847 missense probably benign 0.00
R8723:Dnah10 UTSW 5 124814621 missense probably damaging 0.99
R8770:Dnah10 UTSW 5 124775346 missense possibly damaging 0.94
R8838:Dnah10 UTSW 5 124765550 missense probably benign 0.09
R8879:Dnah10 UTSW 5 124818117 missense probably damaging 1.00
R8945:Dnah10 UTSW 5 124813942 missense probably damaging 0.99
RF015:Dnah10 UTSW 5 124818077 missense probably damaging 1.00
RF021:Dnah10 UTSW 5 124777907 missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124763066 missense probably benign
U24488:Dnah10 UTSW 5 124813980 missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124765697 missense probably benign 0.22
Z1176:Dnah10 UTSW 5 124775355 missense probably benign 0.11
Z1177:Dnah10 UTSW 5 124741955 missense probably damaging 1.00
Z1177:Dnah10 UTSW 5 124747619 missense possibly damaging 0.64
Z1177:Dnah10 UTSW 5 124817988 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCATGAAAGGACATGGCCTG -3'
(R):5'- CAGCCGCTTTAGAAGGATGG -3'

Sequencing Primer
(F):5'- CTCAAATTCAAGGTCTCTGCAGGG -3'
(R):5'- CCGCTTTAGAAGGATGGAGTCG -3'
Posted On2019-06-26