Incidental Mutation 'R7322:Zfp715'
ID 568213
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Name zinc finger protein 715
Synonyms mszf15, 2610041B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 43296197-43313294 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43311138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000040282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
AlphaFold G3X9T1
Predicted Effect probably benign
Transcript: ENSMUST00000012796
AA Change: T10A

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640
AA Change: T10A

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: T10A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: T10A

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: T10A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: T10A

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135130
AA Change: T10A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640
AA Change: T10A

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139061
AA Change: T10A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640
AA Change: T10A

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000145622
AA Change: T10A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7629:Zfp715 UTSW 7 43301676 missense possibly damaging 0.92
R7934:Zfp715 UTSW 7 43299884 nonsense probably null
R7973:Zfp715 UTSW 7 43299897 missense possibly damaging 0.64
R8327:Zfp715 UTSW 7 43298058 missense possibly damaging 0.64
R8348:Zfp715 UTSW 7 43299937 missense possibly damaging 0.53
R8532:Zfp715 UTSW 7 43299405 missense possibly damaging 0.71
R8532:Zfp715 UTSW 7 43299710 missense probably benign 0.00
R8835:Zfp715 UTSW 7 43299006 missense
R9150:Zfp715 UTSW 7 43299289 missense possibly damaging 0.85
R9328:Zfp715 UTSW 7 43297904 missense possibly damaging 0.71
R9332:Zfp715 UTSW 7 43299423 missense probably damaging 0.98
R9619:Zfp715 UTSW 7 43299680 nonsense probably null
R9649:Zfp715 UTSW 7 43301229 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGATGGTCTCAGAAGTCTGC -3'
(R):5'- CAAGAGCAGGGCTTTTATGTATCC -3'

Sequencing Primer
(F):5'- AGAAGTCTGCAGCTTCCTG -3'
(R):5'- GAGCAGGGCTTTTATGTATCCTCTAC -3'
Posted On 2019-06-26