Incidental Mutation 'R7322:Prss8'
ID 568218
Institutional Source Beutler Lab
Gene Symbol Prss8
Ensembl Gene ENSMUSG00000030800
Gene Name protease, serine 8 (prostasin)
Synonyms 2410039E18Rik, CAP1, mCAP1, fr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 127925716-127930104 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127929563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000032988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000033070] [ENSMUST00000094026] [ENSMUST00000118755] [ENSMUST00000141385] [ENSMUST00000156152] [ENSMUST00000206124] [ENSMUST00000206568]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032988
AA Change: T33A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800
AA Change: T33A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033070
SMART Domains Protein: ENSMUSP00000033070
Gene: ENSMUSG00000030801

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
CHROMO 69 123 6.6e-8 SMART
Blast:PHD 177 214 4e-6 BLAST
Pfam:MOZ_SAS 235 412 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094026
SMART Domains Protein: ENSMUSP00000091565
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 556 1.2e-16 PFAM
Pfam:Trypsin 599 798 6.6e-20 PFAM
Pfam:DUF1986 607 707 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118755
SMART Domains Protein: ENSMUSP00000112659
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 545 9.7e-18 PFAM
Pfam:Trypsin 588 787 6.5e-20 PFAM
Pfam:DUF1986 590 696 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141385
SMART Domains Protein: ENSMUSP00000120544
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Blast:Tryp_SPc 38 121 3e-44 BLAST
SCOP:d1eaxa_ 45 126 7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156152
SMART Domains Protein: ENSMUSP00000121706
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Blast:Tryp_SPc 2 44 1e-21 BLAST
Tryp_SPc 89 238 8.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206124
AA Change: T33A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206568
AA Change: T33A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 or chymotrypsin family of serine proteases. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate via a disulfide bond to form the heterodimeric enzyme. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. This protease exhibits trypsin-like substrate specificity, cleaving protein substrates at the carboxyl terminus of lysine or arginine residues. The encoded protease partially mediates proteolytic activation of the epithelial sodium channel, a regulator of sodium balance, and may also play a role in epithelial barrier formation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Nullizygous mutations result in impaired skin barrier function, dehydration, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Prss8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01737:Prss8 APN 7 127926580 missense probably damaging 1.00
PIT1430001:Prss8 UTSW 7 127922252 unclassified probably benign
R0326:Prss8 UTSW 7 127927176 missense probably benign 0.17
R0786:Prss8 UTSW 7 127926474 missense probably benign 0.03
R1381:Prss8 UTSW 7 127929849 small deletion probably benign
R1919:Prss8 UTSW 7 127929858 missense probably benign 0.32
R2074:Prss8 UTSW 7 127927094 missense possibly damaging 0.64
R2075:Prss8 UTSW 7 127927094 missense possibly damaging 0.64
R4492:Prss8 UTSW 7 127929807 missense probably damaging 0.98
R4989:Prss8 UTSW 7 127926463 missense probably benign 0.02
R7286:Prss8 UTSW 7 127926884 missense probably damaging 1.00
R9279:Prss8 UTSW 7 127927910 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTCTACACTGGAGCTGATCTTC -3'
(R):5'- TGTAGACTGAATTCGCGAATCTC -3'

Sequencing Primer
(F):5'- AGAGTCAGGCTTCGATTATGCC -3'
(R):5'- GAATTCGCGAATCTCCGTGTTC -3'
Posted On 2019-06-26