Incidental Mutation 'R7322:Rasa3'
ID 568220
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene Name RAS p21 protein activator 3
Synonyms GAPIII activator 3, Ras GTPase-activating protein III, scat, hlb381, GAPIII, R-Ras gap
MMRRC Submission 045417-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 13617218-13727590 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13645857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 161 (N161S)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551] [ENSMUST00000154454]
AlphaFold Q60790
Predicted Effect possibly damaging
Transcript: ENSMUST00000117551
AA Change: N161S

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: N161S

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154454
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 (GRCm39) V1352D probably damaging Het
Adam33 C T 2: 130,895,614 (GRCm39) C567Y probably damaging Het
Alppl2 C A 1: 87,015,184 (GRCm39) G422C probably benign Het
Ang T A 14: 51,338,868 (GRCm39) I3K unknown Het
Ankrd10 A T 8: 11,665,841 (GRCm39) V253E probably damaging Het
Arhgef17 T C 7: 100,527,004 (GRCm39) I806V probably benign Het
Atp10b T C 11: 43,103,374 (GRCm39) L586P probably damaging Het
Bdkrb1 T C 12: 105,570,563 (GRCm39) V43A possibly damaging Het
Brinp3 C T 1: 146,558,426 (GRCm39) R117* probably null Het
Brwd1 A T 16: 95,867,319 (GRCm39) M172K probably damaging Het
Bsn G A 9: 108,003,620 (GRCm39) R262* probably null Het
Bst2 A C 8: 71,989,851 (GRCm39) L74R probably damaging Het
C1qa T C 4: 136,623,465 (GRCm39) *246W probably null Het
Cadm2 G A 16: 66,679,734 (GRCm39) T42M probably damaging Het
Ccdc150 A G 1: 54,299,125 (GRCm39) T34A probably benign Het
Ccdc178 G A 18: 22,238,606 (GRCm39) T337M probably benign Het
Ccl8 T C 11: 82,007,408 (GRCm39) V81A probably damaging Het
Dgcr6 A G 16: 17,888,771 (GRCm39) T69A unknown Het
Dnah10 A G 5: 124,898,333 (GRCm39) D3762G probably benign Het
Eif3d T C 15: 77,845,876 (GRCm39) T382A probably benign Het
Epb41 A T 4: 131,717,030 (GRCm39) Y375N probably damaging Het
Epb41l1 A T 2: 156,345,771 (GRCm39) H258L probably damaging Het
Fbn1 A C 2: 125,321,115 (GRCm39) I81S possibly damaging Het
Fzd5 A G 1: 64,774,487 (GRCm39) S425P probably damaging Het
Gfra2 T A 14: 71,205,831 (GRCm39) V398D probably benign Het
Gm3755 A G 14: 18,620,904 (GRCm39) L130P Het
Grin3b A G 10: 79,811,529 (GRCm39) Y705C probably damaging Het
Hmcn2 A G 2: 31,349,093 (GRCm39) D4944G probably damaging Het
Hoxd11 T C 2: 74,514,355 (GRCm39) L295P probably damaging Het
Ighv1-81 C A 12: 115,884,287 (GRCm39) G16C possibly damaging Het
Kcna5 T C 6: 126,510,754 (GRCm39) D458G possibly damaging Het
Klb A T 5: 65,540,707 (GRCm39) E933D probably benign Het
Lrp1 A T 10: 127,381,433 (GRCm39) M3855K probably benign Het
Map3k4 A T 17: 12,489,833 (GRCm39) L533I probably damaging Het
Mrps6 C A 16: 91,855,335 (GRCm39) Y4* probably null Het
Nabp1 A T 1: 51,512,229 (GRCm39) V105E probably damaging Het
Naip6 T A 13: 100,435,896 (GRCm39) N876Y possibly damaging Het
Nlrp2 T C 7: 5,311,644 (GRCm39) S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 (GRCm39) E590D probably benign Het
Or10h5 A G 17: 33,434,673 (GRCm39) I215T probably damaging Het
Or1b1 T C 2: 36,995,603 (GRCm39) R20G probably null Het
Or52ab2 T A 7: 102,970,494 (GRCm39) V292E Het
Or5j1 A T 2: 86,878,823 (GRCm39) Y252* probably null Het
Or8k22 C T 2: 86,162,908 (GRCm39) S264N probably benign Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pdzd2 T C 15: 12,437,248 (GRCm39) D451G probably damaging Het
Pkd2l1 A G 19: 44,146,129 (GRCm39) S142P probably benign Het
Postn T C 3: 54,277,701 (GRCm39) L232P probably damaging Het
Prss8 T C 7: 127,528,735 (GRCm39) T33A probably benign Het
Ptgr3 A G 18: 84,113,260 (GRCm39) Y312C probably damaging Het
Rapgef2 A T 3: 79,053,130 (GRCm39) M1K probably null Het
Riox1 G A 12: 83,997,442 (GRCm39) probably benign Het
Rmdn2 A T 17: 79,929,040 (GRCm39) K97N probably damaging Het
Sgo1 A G 17: 53,984,085 (GRCm39) L431P probably damaging Het
Slc9a8 T A 2: 167,293,222 (GRCm39) V217E probably damaging Het
Slco2b1 C T 7: 99,341,055 (GRCm39) G21D not run Het
Spata31d1d C A 13: 59,874,790 (GRCm39) R915L probably benign Het
Stk17b A T 1: 53,805,104 (GRCm39) N152K probably benign Het
Syne2 T A 12: 76,030,798 (GRCm39) I3634N probably damaging Het
Tnfrsf9 A G 4: 151,018,794 (GRCm39) D155G probably damaging Het
Tnrc6a T A 7: 122,770,731 (GRCm39) D840E probably benign Het
Tyk2 G A 9: 21,021,500 (GRCm39) S902L probably benign Het
Unc119 T C 11: 78,239,449 (GRCm39) S235P probably damaging Het
Vav1 A C 17: 57,609,266 (GRCm39) D394A probably benign Het
Vezf1 T A 11: 87,972,410 (GRCm39) I439K possibly damaging Het
Zfp335 A T 2: 164,752,741 (GRCm39) M1K probably null Het
Zfp715 T C 7: 42,960,562 (GRCm39) T10A possibly damaging Het
Zmynd11 C T 13: 9,740,445 (GRCm39) E382K possibly damaging Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13,645,410 (GRCm39) unclassified probably benign
IGL02112:Rasa3 APN 8 13,635,042 (GRCm39) splice site probably benign
IGL02946:Rasa3 APN 8 13,648,280 (GRCm39) missense probably benign 0.33
IGL03085:Rasa3 APN 8 13,635,690 (GRCm39) missense probably benign 0.11
Box_canyon UTSW 8 13,634,959 (GRCm39) nonsense probably null
Erasor UTSW 8 13,636,873 (GRCm39) critical splice donor site probably null
koko_head UTSW 8 13,664,605 (GRCm39) missense possibly damaging 0.70
Mount_ouray UTSW 8 13,681,811 (GRCm39) missense possibly damaging 0.90
Poncha_pass UTSW 8 13,645,373 (GRCm39) missense possibly damaging 0.46
Tabula UTSW 8 13,635,029 (GRCm39) missense probably damaging 1.00
Ute UTSW 8 13,632,381 (GRCm39) splice site probably benign
PIT4531001:Rasa3 UTSW 8 13,655,887 (GRCm39) missense probably benign 0.11
R0193:Rasa3 UTSW 8 13,620,233 (GRCm39) splice site probably null
R0710:Rasa3 UTSW 8 13,633,830 (GRCm39) missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13,630,118 (GRCm39) splice site probably benign
R1405:Rasa3 UTSW 8 13,638,027 (GRCm39) missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13,638,027 (GRCm39) missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13,632,372 (GRCm39) missense probably benign 0.44
R1828:Rasa3 UTSW 8 13,635,035 (GRCm39) missense probably benign 0.02
R1895:Rasa3 UTSW 8 13,681,768 (GRCm39) splice site probably benign
R2090:Rasa3 UTSW 8 13,632,381 (GRCm39) splice site probably benign
R2374:Rasa3 UTSW 8 13,627,411 (GRCm39) missense probably damaging 1.00
R2655:Rasa3 UTSW 8 13,645,373 (GRCm39) missense possibly damaging 0.46
R3703:Rasa3 UTSW 8 13,638,972 (GRCm39) missense probably benign
R3899:Rasa3 UTSW 8 13,628,635 (GRCm39) missense probably benign 0.21
R4230:Rasa3 UTSW 8 13,620,264 (GRCm39) missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13,664,532 (GRCm39) critical splice donor site probably null
R4281:Rasa3 UTSW 8 13,638,946 (GRCm39) missense probably benign 0.01
R4498:Rasa3 UTSW 8 13,664,587 (GRCm39) missense probably benign 0.01
R4558:Rasa3 UTSW 8 13,648,259 (GRCm39) missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13,648,259 (GRCm39) missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13,638,865 (GRCm39) missense probably null 0.00
R4702:Rasa3 UTSW 8 13,620,394 (GRCm39) missense probably benign 0.09
R4772:Rasa3 UTSW 8 13,648,289 (GRCm39) missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13,627,501 (GRCm39) missense probably benign 0.07
R4807:Rasa3 UTSW 8 13,664,633 (GRCm39) missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13,634,959 (GRCm39) nonsense probably null
R5043:Rasa3 UTSW 8 13,620,368 (GRCm39) missense possibly damaging 0.59
R5352:Rasa3 UTSW 8 13,681,778 (GRCm39) missense possibly damaging 0.88
R5435:Rasa3 UTSW 8 13,681,811 (GRCm39) missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13,648,251 (GRCm39) missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13,630,037 (GRCm39) missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13,635,029 (GRCm39) missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13,681,826 (GRCm39) missense probably benign 0.29
R7100:Rasa3 UTSW 8 13,636,897 (GRCm39) missense probably benign 0.02
R7394:Rasa3 UTSW 8 13,645,353 (GRCm39) missense probably benign 0.03
R7478:Rasa3 UTSW 8 13,664,605 (GRCm39) missense possibly damaging 0.70
R7486:Rasa3 UTSW 8 13,640,201 (GRCm39) critical splice donor site probably null
R7554:Rasa3 UTSW 8 13,645,390 (GRCm39) missense probably damaging 0.99
R7575:Rasa3 UTSW 8 13,645,887 (GRCm39) missense possibly damaging 0.73
R7641:Rasa3 UTSW 8 13,634,961 (GRCm39) missense probably benign 0.11
R7667:Rasa3 UTSW 8 13,638,015 (GRCm39) missense probably benign 0.27
R7751:Rasa3 UTSW 8 13,618,708 (GRCm39) missense probably benign 0.18
R7999:Rasa3 UTSW 8 13,681,805 (GRCm39) missense probably benign 0.04
R8039:Rasa3 UTSW 8 13,638,931 (GRCm39) missense probably damaging 1.00
R8125:Rasa3 UTSW 8 13,627,801 (GRCm39) splice site probably null
R8514:Rasa3 UTSW 8 13,631,322 (GRCm39) missense probably benign 0.02
R8726:Rasa3 UTSW 8 13,626,381 (GRCm39) missense probably benign 0.00
R8728:Rasa3 UTSW 8 13,636,873 (GRCm39) critical splice donor site probably null
R8790:Rasa3 UTSW 8 13,727,391 (GRCm39) critical splice donor site probably null
R9036:Rasa3 UTSW 8 13,645,851 (GRCm39) missense probably benign 0.06
R9483:Rasa3 UTSW 8 13,630,033 (GRCm39) critical splice donor site probably null
R9602:Rasa3 UTSW 8 13,681,844 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAAGTATACCTGCCCTCCCG -3'
(R):5'- ACCTAGGTGCTTTGGAGAGG -3'

Sequencing Primer
(F):5'- CCAGAACTGAAACTGGCA -3'
(R):5'- CGTAGTTTGATGAAGGCCACC -3'
Posted On 2019-06-26