Mutagenetix > Incidental Mutations

Incidental Mutation 'R7322:Unc119'

568227

Institutional Source

Beutler Lab

Gene Symbol

Unc119

Ensembl Gene

ENSMUSG00000002058

Gene Name

unc-119 lipid binding chaperone

Synonyms

UNC119, Unc119h, MRG4, HRG4, Rtg4, Rg4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7322 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78343482-78349164 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78348623 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 235 (S235P)

Ref Sequence

ENSEMBL: ENSMUSP00000002127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000100755] [ENSMUST00000108295]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002127
AA Change: S235P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058
AA Change: S235P

Domain	Start	End	E-Value	Type
low complexity region	6	13	N/A	INTRINSIC
low complexity region	29	54	N/A	INTRINSIC
Pfam:GMP_PDE_delta	78	237	1.6e-81	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000100755
AA Change: S170P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000098318
Gene: ENSMUSG00000002058
AA Change: S170P

Domain	Start	End	E-Value	Type
Pfam:GMP_PDE_delta	13	172	1.6e-82	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108295
AA Change: S257P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058
AA Change: S257P

Domain	Start	End	E-Value	Type
low complexity region	6	13	N/A	INTRINSIC
low complexity region	29	54	N/A	INTRINSIC
Pfam:GMP_PDE_delta	80	212	1.3e-60	PFAM
Pfam:GMP_PDE_delta	218	258	1.5e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is multifunctional, affecting trafficking of transducin in rod photoreceptors, interacting with src-type tyrosine kinases through SH2 and SH3 interacting domains, and aiding the uptake of bacteria through endocytosis. In addition, the encoded protein acts as a lipid-binding chaperone to help localize some myristoylated proteins correctly. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit retinal degeneration characterized by thinning of the outer nuclear layer of the retinal that is visible at 6 months and progresses rapidly after 17 to end-stage by 26 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	T	4: 53,067,151	V1352D	probably damaging	Het
Adam33	C	T	2: 131,053,694	C567Y	probably damaging	Het
Alppl2	C	A	1: 87,087,462	G422C	probably benign	Het
Ang	T	A	14: 51,101,411	I3K	unknown	Het
Ankrd10	A	T	8: 11,615,841	V253E	probably damaging	Het
Arhgef17	T	C	7: 100,877,797	I806V	probably benign	Het
Atp10b	T	C	11: 43,212,547	L586P	probably damaging	Het
Bdkrb1	T	C	12: 105,604,304	V43A	possibly damaging	Het
Brinp3	C	T	1: 146,682,688	R117*	probably null	Het
Brwd1	A	T	16: 96,066,119	M172K	probably damaging	Het
Bsn	G	A	9: 108,126,421	R262*	probably null	Het
Bst2	A	C	8: 71,537,207	L74R	probably damaging	Het
C1qa	T	C	4: 136,896,154	*246W	probably null	Het
Cadm2	G	A	16: 66,882,846	T42M	probably damaging	Het
Ccdc150	A	G	1: 54,259,966	T34A	probably benign	Het
Ccdc178	G	A	18: 22,105,549	T337M	probably benign	Het
Ccl8	T	C	11: 82,116,582	V81A	probably damaging	Het
Dgcr6	A	G	16: 18,070,907	T69A	unknown	Het
Dnah10	A	G	5: 124,821,269	D3762G	probably benign	Het
Eif3d	T	C	15: 77,961,676	T382A	probably benign	Het
Epb41	A	T	4: 131,989,719	Y375N	probably damaging	Het
Epb41l1	A	T	2: 156,503,851	H258L	probably damaging	Het
Fbn1	A	C	2: 125,479,195	I81S	possibly damaging	Het
Fzd5	A	G	1: 64,735,328	S425P	probably damaging	Het
Gfra2	T	A	14: 70,968,391	V398D	probably benign	Het
Gm3755	A	G	14: 7,448,178	L130P		Het
Grin3b	A	G	10: 79,975,695	Y705C	probably damaging	Het
Hmcn2	A	G	2: 31,459,081	D4944G	probably damaging	Het
Hoxd11	T	C	2: 74,684,011	L295P	probably damaging	Het
Ighv1-81	C	A	12: 115,920,667	G16C	possibly damaging	Het
Kcna5	T	C	6: 126,533,791	D458G	possibly damaging	Het
Klb	A	T	5: 65,383,364	E933D	probably benign	Het
Lrp1	A	T	10: 127,545,564	M3855K	probably benign	Het
Map3k4	A	T	17: 12,270,946	L533I	probably damaging	Het
Mrps6	C	A	16: 92,058,447	Y4*	probably null	Het
Nabp1	A	T	1: 51,473,070	V105E	probably damaging	Het
Naip6	T	A	13: 100,299,388	N876Y	possibly damaging	Het
Nlrp2	T	C	7: 5,308,645	S944G	possibly damaging	Het
Nr4a3	A	T	4: 48,083,238	E590D	probably benign	Het
Olfr1054	C	T	2: 86,332,564	S264N	probably benign	Het
Olfr1106	A	T	2: 87,048,479	Y252*	probably null	Het
Olfr1564	A	G	17: 33,215,699	I215T	probably damaging	Het
Olfr362	T	C	2: 37,105,591	R20G	probably null	Het
Olfr597	T	A	7: 103,321,287	V292E		Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pdzd2	T	C	15: 12,437,162	D451G	probably damaging	Het
Pkd2l1	A	G	19: 44,157,690	S142P	probably benign	Het
Postn	T	C	3: 54,370,280	L232P	probably damaging	Het
Prss8	T	C	7: 127,929,563	T33A	probably benign	Het
Rapgef2	A	T	3: 79,145,823	M1K	probably null	Het
Rasa3	T	C	8: 13,595,857	N161S	possibly damaging	Het
Riox1	G	A	12: 83,950,668		probably benign	Het
Rmdn2	A	T	17: 79,621,611	K97N	probably damaging	Het
Sgo1	A	G	17: 53,677,057	L431P	probably damaging	Het
Slc9a8	T	A	2: 167,451,302	V217E	probably damaging	Het
Slco2b1	C	T	7: 99,691,848	G21D	not run	Het
Spata31d1d	C	A	13: 59,726,976	R915L	probably benign	Het
Stk17b	A	T	1: 53,765,945	N152K	probably benign	Het
Syne2	T	A	12: 75,984,024	I3634N	probably damaging	Het
Tnfrsf9	A	G	4: 150,934,337	D155G	probably damaging	Het
Tnrc6a	T	A	7: 123,171,508	D840E	probably benign	Het
Tyk2	G	A	9: 21,110,204	S902L	probably benign	Het
Vav1	A	C	17: 57,302,266	D394A	probably benign	Het
Vezf1	T	A	11: 88,081,584	I439K	possibly damaging	Het
Zadh2	A	G	18: 84,095,135	Y312C	probably damaging	Het
Zfp335	A	T	2: 164,910,821	M1K	probably null	Het
Zfp715	T	C	7: 43,311,138	T10A	possibly damaging	Het
Zmynd11	C	T	13: 9,690,409	E382K	possibly damaging	Het

Other mutations in Unc119

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01155:Unc119	APN	11	78348609	missense	probably damaging	1.00
IGL01317:Unc119	APN	11	78347226	missense	probably damaging	0.99
IGL03164:Unc119	APN	11	78348176	missense	probably damaging	1.00
R2166:Unc119	UTSW	11	78347335	splice site	probably null
R4298:Unc119	UTSW	11	78348122	missense	probably damaging	0.98
R5584:Unc119	UTSW	11	78348570	missense	probably damaging	1.00
R6594:Unc119	UTSW	11	78347220	missense	probably damaging	1.00
R7001:Unc119	UTSW	11	78348554	missense	probably damaging	0.99
R7401:Unc119	UTSW	11	78347245	missense	probably benign	0.00
R7675:Unc119	UTSW	11	78343597	missense	probably damaging	1.00
R8700:Unc119	UTSW	11	78347311	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- GTACCTATGCATCTGACCCC -3'
(R):5'- ACTAGCTCCAGAGGTTTGCC -3'

Sequencing Primer
(F):5'- CTCAGGAGCTCTCTGAAGTG -3'
(R):5'- CTAGGGATGCTGGACACCTTTC -3'

Posted On

2019-06-26