Incidental Mutation 'R7322:Unc119'
ID 568227
Institutional Source Beutler Lab
Gene Symbol Unc119
Ensembl Gene ENSMUSG00000002058
Gene Name unc-119 lipid binding chaperone
Synonyms MRG4, Rtg4, Rg4, UNC119, HRG4, Unc119h
MMRRC Submission 045417-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78234321-78239990 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78239449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 235 (S235P)
Ref Sequence ENSEMBL: ENSMUSP00000002127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000100755] [ENSMUST00000108295]
AlphaFold Q9Z2R6
Predicted Effect probably damaging
Transcript: ENSMUST00000002127
AA Change: S235P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058
AA Change: S235P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 78 237 1.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100755
AA Change: S170P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098318
Gene: ENSMUSG00000002058
AA Change: S170P

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 13 172 1.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108295
AA Change: S257P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 80 212 1.3e-60 PFAM
Pfam:GMP_PDE_delta 218 258 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is multifunctional, affecting trafficking of transducin in rod photoreceptors, interacting with src-type tyrosine kinases through SH2 and SH3 interacting domains, and aiding the uptake of bacteria through endocytosis. In addition, the encoded protein acts as a lipid-binding chaperone to help localize some myristoylated proteins correctly. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit retinal degeneration characterized by thinning of the outer nuclear layer of the retinal that is visible at 6 months and progresses rapidly after 17 to end-stage by 26 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 (GRCm39) V1352D probably damaging Het
Adam33 C T 2: 130,895,614 (GRCm39) C567Y probably damaging Het
Alppl2 C A 1: 87,015,184 (GRCm39) G422C probably benign Het
Ang T A 14: 51,338,868 (GRCm39) I3K unknown Het
Ankrd10 A T 8: 11,665,841 (GRCm39) V253E probably damaging Het
Arhgef17 T C 7: 100,527,004 (GRCm39) I806V probably benign Het
Atp10b T C 11: 43,103,374 (GRCm39) L586P probably damaging Het
Bdkrb1 T C 12: 105,570,563 (GRCm39) V43A possibly damaging Het
Brinp3 C T 1: 146,558,426 (GRCm39) R117* probably null Het
Brwd1 A T 16: 95,867,319 (GRCm39) M172K probably damaging Het
Bsn G A 9: 108,003,620 (GRCm39) R262* probably null Het
Bst2 A C 8: 71,989,851 (GRCm39) L74R probably damaging Het
C1qa T C 4: 136,623,465 (GRCm39) *246W probably null Het
Cadm2 G A 16: 66,679,734 (GRCm39) T42M probably damaging Het
Ccdc150 A G 1: 54,299,125 (GRCm39) T34A probably benign Het
Ccdc178 G A 18: 22,238,606 (GRCm39) T337M probably benign Het
Ccl8 T C 11: 82,007,408 (GRCm39) V81A probably damaging Het
Dgcr6 A G 16: 17,888,771 (GRCm39) T69A unknown Het
Dnah10 A G 5: 124,898,333 (GRCm39) D3762G probably benign Het
Eif3d T C 15: 77,845,876 (GRCm39) T382A probably benign Het
Epb41 A T 4: 131,717,030 (GRCm39) Y375N probably damaging Het
Epb41l1 A T 2: 156,345,771 (GRCm39) H258L probably damaging Het
Fbn1 A C 2: 125,321,115 (GRCm39) I81S possibly damaging Het
Fzd5 A G 1: 64,774,487 (GRCm39) S425P probably damaging Het
Gfra2 T A 14: 71,205,831 (GRCm39) V398D probably benign Het
Gm3755 A G 14: 18,620,904 (GRCm39) L130P Het
Grin3b A G 10: 79,811,529 (GRCm39) Y705C probably damaging Het
Hmcn2 A G 2: 31,349,093 (GRCm39) D4944G probably damaging Het
Hoxd11 T C 2: 74,514,355 (GRCm39) L295P probably damaging Het
Ighv1-81 C A 12: 115,884,287 (GRCm39) G16C possibly damaging Het
Kcna5 T C 6: 126,510,754 (GRCm39) D458G possibly damaging Het
Klb A T 5: 65,540,707 (GRCm39) E933D probably benign Het
Lrp1 A T 10: 127,381,433 (GRCm39) M3855K probably benign Het
Map3k4 A T 17: 12,489,833 (GRCm39) L533I probably damaging Het
Mrps6 C A 16: 91,855,335 (GRCm39) Y4* probably null Het
Nabp1 A T 1: 51,512,229 (GRCm39) V105E probably damaging Het
Naip6 T A 13: 100,435,896 (GRCm39) N876Y possibly damaging Het
Nlrp2 T C 7: 5,311,644 (GRCm39) S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 (GRCm39) E590D probably benign Het
Or10h5 A G 17: 33,434,673 (GRCm39) I215T probably damaging Het
Or1b1 T C 2: 36,995,603 (GRCm39) R20G probably null Het
Or52ab2 T A 7: 102,970,494 (GRCm39) V292E Het
Or5j1 A T 2: 86,878,823 (GRCm39) Y252* probably null Het
Or8k22 C T 2: 86,162,908 (GRCm39) S264N probably benign Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pdzd2 T C 15: 12,437,248 (GRCm39) D451G probably damaging Het
Pkd2l1 A G 19: 44,146,129 (GRCm39) S142P probably benign Het
Postn T C 3: 54,277,701 (GRCm39) L232P probably damaging Het
Prss8 T C 7: 127,528,735 (GRCm39) T33A probably benign Het
Ptgr3 A G 18: 84,113,260 (GRCm39) Y312C probably damaging Het
Rapgef2 A T 3: 79,053,130 (GRCm39) M1K probably null Het
Rasa3 T C 8: 13,645,857 (GRCm39) N161S possibly damaging Het
Riox1 G A 12: 83,997,442 (GRCm39) probably benign Het
Rmdn2 A T 17: 79,929,040 (GRCm39) K97N probably damaging Het
Sgo1 A G 17: 53,984,085 (GRCm39) L431P probably damaging Het
Slc9a8 T A 2: 167,293,222 (GRCm39) V217E probably damaging Het
Slco2b1 C T 7: 99,341,055 (GRCm39) G21D not run Het
Spata31d1d C A 13: 59,874,790 (GRCm39) R915L probably benign Het
Stk17b A T 1: 53,805,104 (GRCm39) N152K probably benign Het
Syne2 T A 12: 76,030,798 (GRCm39) I3634N probably damaging Het
Tnfrsf9 A G 4: 151,018,794 (GRCm39) D155G probably damaging Het
Tnrc6a T A 7: 122,770,731 (GRCm39) D840E probably benign Het
Tyk2 G A 9: 21,021,500 (GRCm39) S902L probably benign Het
Vav1 A C 17: 57,609,266 (GRCm39) D394A probably benign Het
Vezf1 T A 11: 87,972,410 (GRCm39) I439K possibly damaging Het
Zfp335 A T 2: 164,752,741 (GRCm39) M1K probably null Het
Zfp715 T C 7: 42,960,562 (GRCm39) T10A possibly damaging Het
Zmynd11 C T 13: 9,740,445 (GRCm39) E382K possibly damaging Het
Other mutations in Unc119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Unc119 APN 11 78,239,435 (GRCm39) missense probably damaging 1.00
IGL01317:Unc119 APN 11 78,238,052 (GRCm39) missense probably damaging 0.99
IGL03164:Unc119 APN 11 78,239,002 (GRCm39) missense probably damaging 1.00
R2166:Unc119 UTSW 11 78,238,161 (GRCm39) splice site probably null
R4298:Unc119 UTSW 11 78,238,948 (GRCm39) missense probably damaging 0.98
R5584:Unc119 UTSW 11 78,239,396 (GRCm39) missense probably damaging 1.00
R6594:Unc119 UTSW 11 78,238,046 (GRCm39) missense probably damaging 1.00
R7001:Unc119 UTSW 11 78,239,380 (GRCm39) missense probably damaging 0.99
R7401:Unc119 UTSW 11 78,238,071 (GRCm39) missense probably benign 0.00
R7675:Unc119 UTSW 11 78,234,423 (GRCm39) missense probably damaging 1.00
R8700:Unc119 UTSW 11 78,238,137 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GTACCTATGCATCTGACCCC -3'
(R):5'- ACTAGCTCCAGAGGTTTGCC -3'

Sequencing Primer
(F):5'- CTCAGGAGCTCTCTGAAGTG -3'
(R):5'- CTAGGGATGCTGGACACCTTTC -3'
Posted On 2019-06-26