Incidental Mutation 'R7322:Bdkrb1'
ID 568232
Institutional Source Beutler Lab
Gene Symbol Bdkrb1
Ensembl Gene ENSMUSG00000041347
Gene Name bradykinin receptor, beta 1
Synonyms B1R, kinin B1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 105603085-105605428 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105604304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 43 (V43A)
Ref Sequence ENSEMBL: ENSMUSP00000138118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041229] [ENSMUST00000182899] [ENSMUST00000183086]
AlphaFold Q61125
Predicted Effect possibly damaging
Transcript: ENSMUST00000041229
AA Change: V43A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045335
Gene: ENSMUSG00000041347
AA Change: V43A

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_1 53 319 4.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000182899
AA Change: V43A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138118
Gene: ENSMUSG00000041347
AA Change: V43A

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_1 53 319 5.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183086
AA Change: V43A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138216
Gene: ENSMUSG00000041347
AA Change: V43A

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_1 53 268 6.7e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bradykinin, a 9 aa peptide, is generated in pathophysiologic conditions such as inflammation, trauma, burns, shock, and allergy. Two types of G-protein coupled receptors have been found which bind bradykinin and mediate responses to these pathophysiologic conditions. The protein encoded by this gene is one of these receptors and is synthesized de novo following tissue injury. Receptor binding leads to an increase in the cytosolic calcium ion concentration, ultimately resulting in chronic and acute inflammatory responses. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null allele display hypoalgesia and altered inflammatory responses while those homozygous for another are reported to have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Bdkrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Bdkrb1 APN 12 105604951 missense probably damaging 1.00
IGL01419:Bdkrb1 APN 12 105604781 missense possibly damaging 0.94
IGL02536:Bdkrb1 APN 12 105605000 missense possibly damaging 0.87
IGL02687:Bdkrb1 APN 12 105604832 missense probably damaging 1.00
R1075:Bdkrb1 UTSW 12 105604303 missense probably benign 0.00
R1652:Bdkrb1 UTSW 12 105604243 missense probably damaging 1.00
R1696:Bdkrb1 UTSW 12 105604502 missense probably benign 0.32
R2046:Bdkrb1 UTSW 12 105604726 missense probably benign 0.43
R5099:Bdkrb1 UTSW 12 105604274 missense probably benign 0.04
R6542:Bdkrb1 UTSW 12 105605093 missense probably damaging 1.00
R7146:Bdkrb1 UTSW 12 105604883 missense probably damaging 1.00
R7995:Bdkrb1 UTSW 12 105605120 missense probably damaging 1.00
R8497:Bdkrb1 UTSW 12 105604204 nonsense probably null
R9019:Bdkrb1 UTSW 12 105604441 missense probably damaging 1.00
R9564:Bdkrb1 UTSW 12 105604819 missense probably benign 0.01
R9565:Bdkrb1 UTSW 12 105604819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGGATAGACCACAGCTG -3'
(R):5'- CCAAAGGGCCAGTTGAAAC -3'

Sequencing Primer
(F):5'- ACCACAGCTGGGCTTGG -3'
(R):5'- AGTTGAAACGGTTCCCAACGTTC -3'
Posted On 2019-06-26