Incidental Mutation 'R7322:Spata31d1d'
ID568235
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Namespermatogenesis associated 31 subfamily D, member 1D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location59725925-59731752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59726976 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 915 (R915L)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
Predicted Effect probably benign
Transcript: ENSMUST00000052978
AA Change: R915L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: R915L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59730215 splice site probably benign
IGL02399:Spata31d1d APN 13 59730140 splice site probably benign
IGL02531:Spata31d1d APN 13 59727934 missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59727864 missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59726864 missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59725979 missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59726133 missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59728243 missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59727973 missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59726024 missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59728191 missense probably benign 0.01
R1736:Spata31d1d UTSW 13 59726497 missense probably benign 0.02
R1750:Spata31d1d UTSW 13 59728695 missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59728122 missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2203:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2204:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59726955 missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59727462 missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59728554 missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59729241 missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59727288 missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59727520 missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59728778 missense probably benign 0.33
R5618:Spata31d1d UTSW 13 59726400 missense probably benign 0.01
R5688:Spata31d1d UTSW 13 59726508 missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59728686 missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59727240 missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59727015 missense probably benign
R6263:Spata31d1d UTSW 13 59725983 missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59726057 missense probably benign 0.01
R6985:Spata31d1d UTSW 13 59731615 missense probably benign 0.00
R7032:Spata31d1d UTSW 13 59728232 missense probably benign
R7174:Spata31d1d UTSW 13 59728580 missense possibly damaging 0.72
R7444:Spata31d1d UTSW 13 59727193 missense probably benign 0.33
R8206:Spata31d1d UTSW 13 59731530 missense probably benign 0.03
Z1176:Spata31d1d UTSW 13 59726167 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGGGCTGTCCTTGTTCAGAC -3'
(R):5'- TAGTCAAAGAGCAGCTCGGTG -3'

Sequencing Primer
(F):5'- TGTTCAGACCCTTGCCTAAG -3'
(R):5'- AGCTCGGTGGCCTTCAAC -3'
Posted On2019-06-26