Incidental Mutation 'R7322:Dgcr6'
ID568242
Institutional Source Beutler Lab
Gene Symbol Dgcr6
Ensembl Gene ENSMUSG00000003531
Gene NameDiGeorge syndrome critical region gene 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location18052860-18071632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18070907 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 69 (T69A)
Ref Sequence ENSEMBL: ENSMUSP00000118954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003620] [ENSMUST00000066027] [ENSMUST00000076757] [ENSMUST00000136776] [ENSMUST00000139861] [ENSMUST00000143343] [ENSMUST00000151266] [ENSMUST00000153123] [ENSMUST00000155387] [ENSMUST00000232554]
Predicted Effect probably benign
Transcript: ENSMUST00000003620
SMART Domains Protein: ENSMUSP00000003620
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Pfam:Pro_dh 119 578 7.7e-87 PFAM
Predicted Effect silent
Transcript: ENSMUST00000066027
SMART Domains Protein: ENSMUSP00000067682
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 1 198 4e-97 PFAM
Predicted Effect silent
Transcript: ENSMUST00000076757
SMART Domains Protein: ENSMUSP00000076044
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126087
SMART Domains Protein: ENSMUSP00000121736
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
Pfam:Pro_dh 25 244 2.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136776
SMART Domains Protein: ENSMUSP00000117597
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
low complexity region 118 129 N/A INTRINSIC
Pfam:Pro_dh 159 479 1.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139861
SMART Domains Protein: ENSMUSP00000123223
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141635
Predicted Effect silent
Transcript: ENSMUST00000143343
SMART Domains Protein: ENSMUSP00000123029
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect silent
Transcript: ENSMUST00000151266
SMART Domains Protein: ENSMUSP00000122572
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 1 195 3.1e-99 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000153123
AA Change: T69A
SMART Domains Protein: ENSMUSP00000118954
Gene: ENSMUSG00000003531
AA Change: T69A

DomainStartEndE-ValueType
Pfam:DGCR6 3 163 9.6e-83 PFAM
Predicted Effect silent
Transcript: ENSMUST00000155387
SMART Domains Protein: ENSMUSP00000123053
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 41 1.6e-10 PFAM
Pfam:DGCR6 59 230 9.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232554
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is similar to the gonadal protein in Drosophila (fruit fly). The encoded protein is thought to play a role in migration of neural crest cells during development. Deletions in the human gene are associated with DiGeorge syndrome (or velocardiofacial syndrome) which has many clinical features including cardiac abnormalities, cleft palate, atypical facial features, hypocalcemia, hypoparathyroidism and defective development or congenital absence of the thymus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Dgcr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Dgcr6 APN 16 18065174 missense possibly damaging 0.89
IGL02483:Dgcr6 APN 16 18065174 missense possibly damaging 0.89
R3841:Dgcr6 UTSW 16 18070213 nonsense probably null
R4837:Dgcr6 UTSW 16 18066846 missense possibly damaging 0.79
R5911:Dgcr6 UTSW 16 18066734 missense probably damaging 1.00
R8309:Dgcr6 UTSW 16 18066734 missense probably damaging 1.00
R8527:Dgcr6 UTSW 16 18069526 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTCTGGTTCCACGGTATC -3'
(R):5'- CTCCAAATCTGAACAGTGGATGG -3'

Sequencing Primer
(F):5'- ACGGTATCCAGTTTCCACAGG -3'
(R):5'- GCATAGCCAGGATCTAATCAGC -3'
Posted On2019-06-26