Incidental Mutation 'R7322:Cadm2'
ID568243
Institutional Source Beutler Lab
Gene Symbol Cadm2
Ensembl Gene ENSMUSG00000064115
Gene Namecell adhesion molecule 2
SynonymsA830029E02Rik, Necl3, 2900078E11Rik, Igsf4d, SynCAM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location66655421-67620908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66882846 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 42 (T42M)
Ref Sequence ENSEMBL: ENSMUSP00000109931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000123266] [ENSMUST00000128168]
PDB Structure
Crystal structure of Ig1 domain of mouse SynCAM 2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000114292
AA Change: T42M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: T42M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 130 2.19e-9 SMART
Pfam:Ig_3 135 216 1.2e-6 PFAM
Pfam:C2-set_2 135 222 6.4e-17 PFAM
Pfam:Ig_2 135 228 1.8e-6 PFAM
Pfam:I-set 136 229 1.3e-7 PFAM
Pfam:C1-set 142 225 1.5e-9 PFAM
IGc2 248 312 2.56e-10 SMART
4.1m 357 375 5.39e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120594
AA Change: T33M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: T33M

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 4.2e-7 PFAM
Pfam:C2-set_2 126 213 1.8e-16 PFAM
Pfam:I-set 127 220 1.5e-7 PFAM
Pfam:C1-set 133 216 7e-10 PFAM
Pfam:ig 133 218 9.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120898
AA Change: T33M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: T33M

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.2e-6 PFAM
Pfam:C2-set_2 126 213 6.2e-17 PFAM
Pfam:Ig_2 126 219 1.7e-6 PFAM
Pfam:I-set 127 220 1.3e-7 PFAM
Pfam:C1-set 133 216 1.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
4.1m 348 366 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123266
SMART Domains Protein: ENSMUSP00000123192
Gene: ENSMUSG00000064115

DomainStartEndE-ValueType
Blast:IG_like 19 53 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000128168
AA Change: T33M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: T33M

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.4e-6 PFAM
Pfam:C2-set_2 126 213 7.2e-16 PFAM
Pfam:I-set 127 220 5e-7 PFAM
Pfam:C1-set 133 216 2.2e-9 PFAM
Pfam:ig 133 218 3.6e-8 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Cadm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cadm2 APN 16 66882751 missense probably damaging 1.00
IGL01137:Cadm2 APN 16 66815350 missense probably damaging 1.00
IGL01340:Cadm2 APN 16 66784785 missense possibly damaging 0.62
IGL01406:Cadm2 APN 16 66815304 splice site probably null
IGL02029:Cadm2 APN 16 66747296 missense probably damaging 1.00
IGL02541:Cadm2 APN 16 66882882 missense possibly damaging 0.73
IGL02541:Cadm2 APN 16 66882883 critical splice acceptor site probably null
IGL02952:Cadm2 APN 16 66664452 missense probably damaging 0.99
elucidated UTSW 16 66882841 missense probably benign 0.04
vitro UTSW 16 66882832 nonsense probably null
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0399:Cadm2 UTSW 16 66747339 nonsense probably null
R0883:Cadm2 UTSW 16 66882814 missense probably damaging 1.00
R1035:Cadm2 UTSW 16 66815347 missense probably damaging 1.00
R1539:Cadm2 UTSW 16 66784840 missense probably damaging 1.00
R1889:Cadm2 UTSW 16 66882795 missense probably damaging 1.00
R1898:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R1918:Cadm2 UTSW 16 66747384 splice site probably benign
R2108:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R2570:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R3878:Cadm2 UTSW 16 66815441 missense probably damaging 1.00
R4093:Cadm2 UTSW 16 66784788 missense possibly damaging 0.94
R4094:Cadm2 UTSW 16 66882797 missense probably damaging 1.00
R5421:Cadm2 UTSW 16 66771627 nonsense probably null
R5555:Cadm2 UTSW 16 66784815 missense probably damaging 1.00
R6173:Cadm2 UTSW 16 66882841 missense probably benign 0.04
R6188:Cadm2 UTSW 16 66815307 critical splice donor site probably null
R6224:Cadm2 UTSW 16 66664395 missense probably damaging 1.00
R6492:Cadm2 UTSW 16 66784828 missense probably damaging 0.98
R6957:Cadm2 UTSW 16 66812838 missense probably benign 0.02
R7051:Cadm2 UTSW 16 66882879 missense possibly damaging 0.86
R7183:Cadm2 UTSW 16 66882832 nonsense probably null
R7792:Cadm2 UTSW 16 66771637 missense probably benign 0.01
R7882:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R8101:Cadm2 UTSW 16 66812842 missense possibly damaging 0.75
R8166:Cadm2 UTSW 16 66953309 missense probably benign 0.01
R8325:Cadm2 UTSW 16 66815450 missense possibly damaging 0.95
R8496:Cadm2 UTSW 16 66664423 missense probably damaging 1.00
X0026:Cadm2 UTSW 16 66663152 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTACACGCAGCAGCAGTTTAG -3'
(R):5'- AAAATATAATGGTGTGCCTGTAGGG -3'

Sequencing Primer
(F):5'- CGCAGCAGCAGTTTAGTAATC -3'
(R):5'- AGGGTGGTCTAATGATTTGAAATTGC -3'
Posted On2019-06-26