Incidental Mutation 'R7322:Map3k4'
ID 568246
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Name mitogen-activated protein kinase kinase kinase 4
Synonyms D17Rp17, D17Rp17e, RP17, MAPKKK4, Mekk4, MTK1, Tas
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12227621-12318660 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12270946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 533 (L533I)
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
AlphaFold O08648
Predicted Effect probably damaging
Transcript: ENSMUST00000089058
AA Change: L533I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: L533I

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12232990 missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12255200 missense probably benign 0.01
IGL01125:Map3k4 APN 17 12271962 missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12248959 missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12248995 missense probably benign 0.30
IGL02194:Map3k4 APN 17 12263928 missense probably damaging 1.00
IGL02292:Map3k4 APN 17 12235158 missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12249010 missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12271610 missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12264013 missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12235953 missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12271914 missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12272149 missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12238158 missense probably benign 0.01
IGL03238:Map3k4 APN 17 12271158 missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12232976 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0128:Map3k4 UTSW 17 12248063 missense probably damaging 0.99
R0183:Map3k4 UTSW 17 12235128 missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12271015 frame shift probably null
R0355:Map3k4 UTSW 17 12254171 missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12258041 splice site probably benign
R1103:Map3k4 UTSW 17 12237063 splice site probably null
R1446:Map3k4 UTSW 17 12256794 nonsense probably null
R1542:Map3k4 UTSW 17 12235906 missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12249571 missense probably benign 0.39
R1777:Map3k4 UTSW 17 12271730 missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12264019 missense probably benign 0.30
R1997:Map3k4 UTSW 17 12254995 critical splice donor site probably null
R2042:Map3k4 UTSW 17 12277983 missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12264067 missense probably benign 0.00
R2939:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R3405:Map3k4 UTSW 17 12256781 missense probably damaging 1.00
R3930:Map3k4 UTSW 17 12235993 missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12255260 missense probably benign 0.08
R4410:Map3k4 UTSW 17 12248998 missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12232504 missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12264045 missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12232964 missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12248974 missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12271780 missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12272019 missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12271900 missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12249495 critical splice donor site probably null
R4980:Map3k4 UTSW 17 12272071 missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12232434 missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12271610 missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12247308 missense possibly damaging 0.87
R5550:Map3k4 UTSW 17 12243558 nonsense probably null
R5824:Map3k4 UTSW 17 12229639 missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12271416 missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12264058 missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12272067 missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12249583 missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12242692 missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12260491 missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12271344 missense probably damaging 1.00
R6644:Map3k4 UTSW 17 12232410 critical splice donor site probably null
R6909:Map3k4 UTSW 17 12270985 missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12260569 nonsense probably null
R6970:Map3k4 UTSW 17 12248916 missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12271467 missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12272068 missense probably benign 0.00
R7267:Map3k4 UTSW 17 12271649 nonsense probably null
R7522:Map3k4 UTSW 17 12261332 missense probably benign 0.39
R7554:Map3k4 UTSW 17 12232413 missense probably damaging 1.00
R7554:Map3k4 UTSW 17 12232414 nonsense probably null
R7681:Map3k4 UTSW 17 12318543 missense unknown
R7734:Map3k4 UTSW 17 12264111 missense probably damaging 1.00
R7842:Map3k4 UTSW 17 12271143 missense possibly damaging 0.54
R8013:Map3k4 UTSW 17 12271031 nonsense probably null
R8014:Map3k4 UTSW 17 12271031 nonsense probably null
R8235:Map3k4 UTSW 17 12240081 splice site probably null
R8294:Map3k4 UTSW 17 12318613 missense unknown
R8528:Map3k4 UTSW 17 12232934 missense probably damaging 1.00
R8858:Map3k4 UTSW 17 12271872 missense probably damaging 1.00
R8924:Map3k4 UTSW 17 12271546 missense probably benign 0.00
R9063:Map3k4 UTSW 17 12263991 missense probably damaging 1.00
R9224:Map3k4 UTSW 17 12238086 missense probably damaging 0.99
R9446:Map3k4 UTSW 17 12232488 missense probably damaging 1.00
R9486:Map3k4 UTSW 17 12270973 missense probably damaging 1.00
R9488:Map3k4 UTSW 17 12270973 missense probably damaging 1.00
R9591:Map3k4 UTSW 17 12235908 missense possibly damaging 0.91
R9617:Map3k4 UTSW 17 12257984 missense possibly damaging 0.67
R9722:Map3k4 UTSW 17 12271636 missense probably benign 0.01
X0067:Map3k4 UTSW 17 12264094 missense probably benign 0.03
Z1177:Map3k4 UTSW 17 12271697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATAACACTTTAACTTACAGCAG -3'
(R):5'- CTGGCCAGTGTTTGAAATCCCC -3'

Sequencing Primer
(F):5'- CTGTCATTTATGCCTTGAAATGC -3'
(R):5'- AGACGCCATCTTGGACAGTC -3'
Posted On 2019-06-26