Incidental Mutation 'R7322:Map3k4'
ID 568246
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Name mitogen-activated protein kinase kinase kinase 4
Synonyms T-associated sex reversal, D17Rp17, D17Rp17e, Mekk4, Tas, RP17, MAPKKK4, MTK1
MMRRC Submission 045417-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R7322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12446508-12537683 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12489833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 533 (L533I)
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
AlphaFold O08648
Predicted Effect probably damaging
Transcript: ENSMUST00000089058
AA Change: L533I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: L533I

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 (GRCm39) V1352D probably damaging Het
Adam33 C T 2: 130,895,614 (GRCm39) C567Y probably damaging Het
Alppl2 C A 1: 87,015,184 (GRCm39) G422C probably benign Het
Ang T A 14: 51,338,868 (GRCm39) I3K unknown Het
Ankrd10 A T 8: 11,665,841 (GRCm39) V253E probably damaging Het
Arhgef17 T C 7: 100,527,004 (GRCm39) I806V probably benign Het
Atp10b T C 11: 43,103,374 (GRCm39) L586P probably damaging Het
Bdkrb1 T C 12: 105,570,563 (GRCm39) V43A possibly damaging Het
Brinp3 C T 1: 146,558,426 (GRCm39) R117* probably null Het
Brwd1 A T 16: 95,867,319 (GRCm39) M172K probably damaging Het
Bsn G A 9: 108,003,620 (GRCm39) R262* probably null Het
Bst2 A C 8: 71,989,851 (GRCm39) L74R probably damaging Het
C1qa T C 4: 136,623,465 (GRCm39) *246W probably null Het
Cadm2 G A 16: 66,679,734 (GRCm39) T42M probably damaging Het
Ccdc150 A G 1: 54,299,125 (GRCm39) T34A probably benign Het
Ccdc178 G A 18: 22,238,606 (GRCm39) T337M probably benign Het
Ccl8 T C 11: 82,007,408 (GRCm39) V81A probably damaging Het
Dgcr6 A G 16: 17,888,771 (GRCm39) T69A unknown Het
Dnah10 A G 5: 124,898,333 (GRCm39) D3762G probably benign Het
Eif3d T C 15: 77,845,876 (GRCm39) T382A probably benign Het
Epb41 A T 4: 131,717,030 (GRCm39) Y375N probably damaging Het
Epb41l1 A T 2: 156,345,771 (GRCm39) H258L probably damaging Het
Fbn1 A C 2: 125,321,115 (GRCm39) I81S possibly damaging Het
Fzd5 A G 1: 64,774,487 (GRCm39) S425P probably damaging Het
Gfra2 T A 14: 71,205,831 (GRCm39) V398D probably benign Het
Gm3755 A G 14: 18,620,904 (GRCm39) L130P Het
Grin3b A G 10: 79,811,529 (GRCm39) Y705C probably damaging Het
Hmcn2 A G 2: 31,349,093 (GRCm39) D4944G probably damaging Het
Hoxd11 T C 2: 74,514,355 (GRCm39) L295P probably damaging Het
Ighv1-81 C A 12: 115,884,287 (GRCm39) G16C possibly damaging Het
Kcna5 T C 6: 126,510,754 (GRCm39) D458G possibly damaging Het
Klb A T 5: 65,540,707 (GRCm39) E933D probably benign Het
Lrp1 A T 10: 127,381,433 (GRCm39) M3855K probably benign Het
Mrps6 C A 16: 91,855,335 (GRCm39) Y4* probably null Het
Nabp1 A T 1: 51,512,229 (GRCm39) V105E probably damaging Het
Naip6 T A 13: 100,435,896 (GRCm39) N876Y possibly damaging Het
Nlrp2 T C 7: 5,311,644 (GRCm39) S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 (GRCm39) E590D probably benign Het
Or10h5 A G 17: 33,434,673 (GRCm39) I215T probably damaging Het
Or1b1 T C 2: 36,995,603 (GRCm39) R20G probably null Het
Or52ab2 T A 7: 102,970,494 (GRCm39) V292E Het
Or5j1 A T 2: 86,878,823 (GRCm39) Y252* probably null Het
Or8k22 C T 2: 86,162,908 (GRCm39) S264N probably benign Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pdzd2 T C 15: 12,437,248 (GRCm39) D451G probably damaging Het
Pkd2l1 A G 19: 44,146,129 (GRCm39) S142P probably benign Het
Postn T C 3: 54,277,701 (GRCm39) L232P probably damaging Het
Prss8 T C 7: 127,528,735 (GRCm39) T33A probably benign Het
Ptgr3 A G 18: 84,113,260 (GRCm39) Y312C probably damaging Het
Rapgef2 A T 3: 79,053,130 (GRCm39) M1K probably null Het
Rasa3 T C 8: 13,645,857 (GRCm39) N161S possibly damaging Het
Riox1 G A 12: 83,997,442 (GRCm39) probably benign Het
Rmdn2 A T 17: 79,929,040 (GRCm39) K97N probably damaging Het
Sgo1 A G 17: 53,984,085 (GRCm39) L431P probably damaging Het
Slc9a8 T A 2: 167,293,222 (GRCm39) V217E probably damaging Het
Slco2b1 C T 7: 99,341,055 (GRCm39) G21D not run Het
Spata31d1d C A 13: 59,874,790 (GRCm39) R915L probably benign Het
Stk17b A T 1: 53,805,104 (GRCm39) N152K probably benign Het
Syne2 T A 12: 76,030,798 (GRCm39) I3634N probably damaging Het
Tnfrsf9 A G 4: 151,018,794 (GRCm39) D155G probably damaging Het
Tnrc6a T A 7: 122,770,731 (GRCm39) D840E probably benign Het
Tyk2 G A 9: 21,021,500 (GRCm39) S902L probably benign Het
Unc119 T C 11: 78,239,449 (GRCm39) S235P probably damaging Het
Vav1 A C 17: 57,609,266 (GRCm39) D394A probably benign Het
Vezf1 T A 11: 87,972,410 (GRCm39) I439K possibly damaging Het
Zfp335 A T 2: 164,752,741 (GRCm39) M1K probably null Het
Zfp715 T C 7: 42,960,562 (GRCm39) T10A possibly damaging Het
Zmynd11 C T 13: 9,740,445 (GRCm39) E382K possibly damaging Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12,451,877 (GRCm39) missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12,474,087 (GRCm39) missense probably benign 0.01
IGL01125:Map3k4 APN 17 12,490,849 (GRCm39) missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12,467,846 (GRCm39) missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12,482,815 (GRCm39) missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12,467,882 (GRCm39) missense probably benign 0.30
IGL02292:Map3k4 APN 17 12,454,045 (GRCm39) missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12,467,897 (GRCm39) missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12,490,497 (GRCm39) missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12,482,900 (GRCm39) missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12,454,840 (GRCm39) missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12,490,801 (GRCm39) missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12,491,036 (GRCm39) missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12,457,045 (GRCm39) missense probably benign 0.01
IGL03238:Map3k4 APN 17 12,490,045 (GRCm39) missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12,451,863 (GRCm39) missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12,457,076 (GRCm39) missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12,457,076 (GRCm39) missense probably damaging 1.00
R0128:Map3k4 UTSW 17 12,466,950 (GRCm39) missense probably damaging 0.99
R0183:Map3k4 UTSW 17 12,454,015 (GRCm39) missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12,489,902 (GRCm39) frame shift probably null
R0355:Map3k4 UTSW 17 12,473,058 (GRCm39) missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12,476,928 (GRCm39) splice site probably benign
R1103:Map3k4 UTSW 17 12,455,950 (GRCm39) splice site probably null
R1446:Map3k4 UTSW 17 12,475,681 (GRCm39) nonsense probably null
R1542:Map3k4 UTSW 17 12,454,793 (GRCm39) missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12,468,458 (GRCm39) missense probably benign 0.39
R1777:Map3k4 UTSW 17 12,490,617 (GRCm39) missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12,482,906 (GRCm39) missense probably benign 0.30
R1997:Map3k4 UTSW 17 12,473,882 (GRCm39) critical splice donor site probably null
R2042:Map3k4 UTSW 17 12,496,870 (GRCm39) missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12,482,954 (GRCm39) missense probably benign 0.00
R2939:Map3k4 UTSW 17 12,480,157 (GRCm39) missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12,480,157 (GRCm39) missense probably damaging 0.98
R3405:Map3k4 UTSW 17 12,475,668 (GRCm39) missense probably damaging 1.00
R3930:Map3k4 UTSW 17 12,454,880 (GRCm39) missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12,474,147 (GRCm39) missense probably benign 0.08
R4410:Map3k4 UTSW 17 12,467,885 (GRCm39) missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12,451,391 (GRCm39) missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12,482,932 (GRCm39) missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12,451,851 (GRCm39) missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12,467,861 (GRCm39) missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12,490,667 (GRCm39) missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12,490,906 (GRCm39) missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12,490,787 (GRCm39) missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12,468,382 (GRCm39) critical splice donor site probably null
R4980:Map3k4 UTSW 17 12,490,958 (GRCm39) missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12,451,321 (GRCm39) missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12,490,497 (GRCm39) missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12,466,195 (GRCm39) missense possibly damaging 0.87
R5550:Map3k4 UTSW 17 12,462,445 (GRCm39) nonsense probably null
R5824:Map3k4 UTSW 17 12,448,526 (GRCm39) missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12,490,303 (GRCm39) missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12,482,945 (GRCm39) missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12,490,954 (GRCm39) missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12,468,470 (GRCm39) missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12,461,579 (GRCm39) missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12,479,378 (GRCm39) missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12,490,231 (GRCm39) missense probably damaging 1.00
R6644:Map3k4 UTSW 17 12,451,297 (GRCm39) critical splice donor site probably null
R6909:Map3k4 UTSW 17 12,489,872 (GRCm39) missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12,479,456 (GRCm39) nonsense probably null
R6970:Map3k4 UTSW 17 12,467,803 (GRCm39) missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12,490,354 (GRCm39) missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12,490,955 (GRCm39) missense probably benign 0.00
R7267:Map3k4 UTSW 17 12,490,536 (GRCm39) nonsense probably null
R7522:Map3k4 UTSW 17 12,480,219 (GRCm39) missense probably benign 0.39
R7554:Map3k4 UTSW 17 12,451,301 (GRCm39) nonsense probably null
R7554:Map3k4 UTSW 17 12,451,300 (GRCm39) missense probably damaging 1.00
R7681:Map3k4 UTSW 17 12,537,430 (GRCm39) missense unknown
R7734:Map3k4 UTSW 17 12,482,998 (GRCm39) missense probably damaging 1.00
R7842:Map3k4 UTSW 17 12,490,030 (GRCm39) missense possibly damaging 0.54
R8013:Map3k4 UTSW 17 12,489,918 (GRCm39) nonsense probably null
R8014:Map3k4 UTSW 17 12,489,918 (GRCm39) nonsense probably null
R8235:Map3k4 UTSW 17 12,458,968 (GRCm39) splice site probably null
R8294:Map3k4 UTSW 17 12,537,500 (GRCm39) missense unknown
R8528:Map3k4 UTSW 17 12,451,821 (GRCm39) missense probably damaging 1.00
R8858:Map3k4 UTSW 17 12,490,759 (GRCm39) missense probably damaging 1.00
R8924:Map3k4 UTSW 17 12,490,433 (GRCm39) missense probably benign 0.00
R9063:Map3k4 UTSW 17 12,482,878 (GRCm39) missense probably damaging 1.00
R9224:Map3k4 UTSW 17 12,456,973 (GRCm39) missense probably damaging 0.99
R9446:Map3k4 UTSW 17 12,451,375 (GRCm39) missense probably damaging 1.00
R9486:Map3k4 UTSW 17 12,489,860 (GRCm39) missense probably damaging 1.00
R9488:Map3k4 UTSW 17 12,489,860 (GRCm39) missense probably damaging 1.00
R9591:Map3k4 UTSW 17 12,454,795 (GRCm39) missense possibly damaging 0.91
R9617:Map3k4 UTSW 17 12,476,871 (GRCm39) missense possibly damaging 0.67
R9722:Map3k4 UTSW 17 12,490,523 (GRCm39) missense probably benign 0.01
X0067:Map3k4 UTSW 17 12,482,981 (GRCm39) missense probably benign 0.03
Z1177:Map3k4 UTSW 17 12,490,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATAACACTTTAACTTACAGCAG -3'
(R):5'- CTGGCCAGTGTTTGAAATCCCC -3'

Sequencing Primer
(F):5'- CTGTCATTTATGCCTTGAAATGC -3'
(R):5'- AGACGCCATCTTGGACAGTC -3'
Posted On 2019-06-26