Incidental Mutation 'R0638:Olfr810'
ID56825
Institutional Source Beutler Lab
Gene Symbol Olfr810
Ensembl Gene ENSMUSG00000069421
Gene Nameolfactory receptor 810
SynonymsMOR113-4, GA_x6K02T2PULF-11470271-11469333
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0638 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129787289-129794917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129791232 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 119 (D119V)
Ref Sequence ENSEMBL: ENSMUSP00000150364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091986] [ENSMUST00000214206] [ENSMUST00000214878] [ENSMUST00000217283]
Predicted Effect probably damaging
Transcript: ENSMUST00000091986
AA Change: D119V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089612
Gene: ENSMUSG00000069421
AA Change: D119V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.3e-50 PFAM
Pfam:7tm_1 39 288 5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214206
AA Change: D119V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214878
AA Change: D119V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217283
AA Change: D119V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Olfr810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr810 APN 10 129791319 missense probably damaging 0.98
IGL02365:Olfr810 APN 10 129791535 missense possibly damaging 0.81
IGL02508:Olfr810 APN 10 129790791 missense probably benign 0.44
R0680:Olfr810 UTSW 10 129790818 missense probably damaging 1.00
R0847:Olfr810 UTSW 10 129791458 missense probably damaging 1.00
R1449:Olfr810 UTSW 10 129790854 missense probably damaging 1.00
R1776:Olfr810 UTSW 10 129791131 missense probably benign 0.00
R1938:Olfr810 UTSW 10 129790890 missense probably damaging 1.00
R3836:Olfr810 UTSW 10 129791170 missense probably benign 0.01
R4521:Olfr810 UTSW 10 129791181 missense possibly damaging 0.58
R4816:Olfr810 UTSW 10 129791439 missense probably damaging 1.00
R6287:Olfr810 UTSW 10 129791385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCATTGTTTCCAGGAGCTGTG -3'
(R):5'- TCTGCTCAGCATCACTGGCAATC -3'

Sequencing Primer
(F):5'- TGGAGTTGTGTCACAGTAGAAATG -3'
(R):5'- CTGGTGGATACTCACCTGAAGAC -3'
Posted On2013-07-11