Incidental Mutation 'R7322:Ccdc178'
ID568251
Institutional Source Beutler Lab
Gene Symbol Ccdc178
Ensembl Gene ENSMUSG00000024306
Gene Namecoiled coil domain containing 178
Synonyms4921528I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location21810897-22171396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22105549 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 337 (T337M)
Ref Sequence ENSEMBL: ENSMUSP00000025160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025160] [ENSMUST00000115837]
Predicted Effect probably benign
Transcript: ENSMUST00000025160
AA Change: T337M

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025160
Gene: ENSMUSG00000024306
AA Change: T337M

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115837
AA Change: T337M

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111503
Gene: ENSMUSG00000024306
AA Change: T337M

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Ccdc178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Ccdc178 APN 18 21844911 missense probably benign 0.05
IGL00743:Ccdc178 APN 18 22145444 splice site probably benign
IGL00906:Ccdc178 APN 18 22135168 nonsense probably null
IGL01352:Ccdc178 APN 18 22018974 splice site probably benign
IGL01553:Ccdc178 APN 18 21915006 missense probably damaging 0.97
IGL01607:Ccdc178 APN 18 22067721 missense probably benign 0.01
IGL01733:Ccdc178 APN 18 22024812 splice site probably benign
IGL01795:Ccdc178 APN 18 22019118 missense probably benign 0.04
IGL01996:Ccdc178 APN 18 22097756 missense probably damaging 0.99
IGL02939:Ccdc178 APN 18 22120718 missense probably benign 0.01
IGL03213:Ccdc178 APN 18 22120691 missense possibly damaging 0.89
IGL03253:Ccdc178 APN 18 21845011 nonsense probably null
IGL03331:Ccdc178 APN 18 21811583 splice site probably null
PIT4520001:Ccdc178 UTSW 18 22067413 missense probably damaging 0.97
R0121:Ccdc178 UTSW 18 21845024 critical splice acceptor site probably null
R0153:Ccdc178 UTSW 18 22150435 missense probably benign 0.00
R0364:Ccdc178 UTSW 18 21915062 missense probably damaging 0.97
R0604:Ccdc178 UTSW 18 22067443 missense probably benign 0.01
R0709:Ccdc178 UTSW 18 22067662 missense probably damaging 0.97
R0961:Ccdc178 UTSW 18 22019041 missense possibly damaging 0.79
R1029:Ccdc178 UTSW 18 22097725 missense possibly damaging 0.89
R1456:Ccdc178 UTSW 18 22150424 missense possibly damaging 0.81
R1481:Ccdc178 UTSW 18 22105621 missense probably benign 0.00
R1596:Ccdc178 UTSW 18 22020873 missense possibly damaging 0.79
R1739:Ccdc178 UTSW 18 22097723 missense possibly damaging 0.92
R1838:Ccdc178 UTSW 18 22067638 missense probably damaging 0.97
R2214:Ccdc178 UTSW 18 21914990 missense possibly damaging 0.73
R2401:Ccdc178 UTSW 18 22131414 critical splice donor site probably null
R2679:Ccdc178 UTSW 18 21811556 missense possibly damaging 0.90
R3051:Ccdc178 UTSW 18 22135131 missense probably benign 0.05
R3150:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3151:Ccdc178 UTSW 18 21811561 missense probably benign 0.00
R3177:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3277:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3903:Ccdc178 UTSW 18 22023095 missense possibly damaging 0.79
R4184:Ccdc178 UTSW 18 22024784 missense probably damaging 1.00
R4258:Ccdc178 UTSW 18 22017335 splice site probably null
R4319:Ccdc178 UTSW 18 22033543 nonsense probably null
R4321:Ccdc178 UTSW 18 22033543 nonsense probably null
R4323:Ccdc178 UTSW 18 22033543 nonsense probably null
R4509:Ccdc178 UTSW 18 22067392 missense possibly damaging 0.94
R4672:Ccdc178 UTSW 18 22150444 nonsense probably null
R5078:Ccdc178 UTSW 18 22067628 critical splice donor site probably null
R5099:Ccdc178 UTSW 18 22105591 missense probably benign
R5679:Ccdc178 UTSW 18 22067429 missense probably benign
R5683:Ccdc178 UTSW 18 22130122 missense probably benign 0.00
R6120:Ccdc178 UTSW 18 22097728 missense probably benign 0.00
R6318:Ccdc178 UTSW 18 22120534 missense possibly damaging 0.90
R6717:Ccdc178 UTSW 18 22020889 missense probably damaging 0.98
R6853:Ccdc178 UTSW 18 22109876 missense probably benign 0.00
R6980:Ccdc178 UTSW 18 22105563 missense probably benign
R7019:Ccdc178 UTSW 18 22150438 missense probably benign 0.00
R7246:Ccdc178 UTSW 18 22109754 missense possibly damaging 0.92
R7340:Ccdc178 UTSW 18 22017461 missense probably benign 0.17
R7371:Ccdc178 UTSW 18 22130138 missense probably benign 0.01
R8003:Ccdc178 UTSW 18 21844887 critical splice donor site probably null
R8371:Ccdc178 UTSW 18 21811504 missense possibly damaging 0.90
R8670:Ccdc178 UTSW 18 22097662 missense possibly damaging 0.89
R8695:Ccdc178 UTSW 18 22024752 missense probably benign 0.02
R8885:Ccdc178 UTSW 18 22067664 missense probably damaging 0.98
X0063:Ccdc178 UTSW 18 21844912 missense probably benign 0.12
Z1177:Ccdc178 UTSW 18 22109731 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CAGGGAGATACATTGCTTTTATGCC -3'
(R):5'- ACCTAAAGTATGAGTGACACTGG -3'

Sequencing Primer
(F):5'- TGCCTTATCCTCATGAAATTTAGTG -3'
(R):5'- GAGCTTAAAGAGTCTGTGGATA -3'
Posted On2019-06-26