Incidental Mutation 'R7323:Abcb11'
ID568261
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R7323 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69287635 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 466 (Q466H)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: Q466H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: Q466H

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: Q466H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: Q466H

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: Q466H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: Q466H

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
6030452D12Rik A T 8: 106,500,779 probably null Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm11639 T C 11: 105,030,011 L4676P probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Myh2 A T 11: 67,197,365 T1936S probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr1509 A G 14: 52,451,213 I267V probably benign Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc27a2 T G 2: 126,553,204 L17R probably benign Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Themis A T 10: 28,733,501 H88L probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Tnfrsf11a A G 1: 105,844,730 D581G probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r69 A C 7: 85,411,764 I204R possibly damaging Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7842:Abcb11 UTSW 2 69323873 small deletion probably benign
R7894:Abcb11 UTSW 2 69323873 small deletion probably benign
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7898:Abcb11 UTSW 2 69323873 small deletion probably benign
R7917:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTGAAATTACAAATGTGAGCC -3'
(R):5'- CACCCTATGTATGGCCTCATTG -3'

Sequencing Primer
(F):5'- GGAGGAAGGAAGGAAGGAAGG -3'
(R):5'- CCTCATTGCTTGGTTAGGTGCAC -3'
Posted On2019-06-26