Incidental Mutation 'R0638:Tmem94'
ID 56827
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Name transmembrane protein 94
Synonyms 2310067B10Rik
MMRRC Submission 038827-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.276) question?
Stock # R0638 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 115656245-115689859 bp(+) (GRCm39)
Type of Mutation splice site (82 bp from exon)
DNA Base Change (assembly) T to C at 115682886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000125918]
AlphaFold Q7TSH8
Predicted Effect probably damaging
Transcript: ENSMUST00000093912
AA Change: I641T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: I641T

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103033
AA Change: I641T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: I641T

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175989
Meta Mutation Damage Score 0.6936 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,547,572 (GRCm39) Q161K probably benign Het
Aatk A T 11: 119,900,748 (GRCm39) L1216Q probably damaging Het
Aifm3 T C 16: 17,321,535 (GRCm39) F463L possibly damaging Het
Antxr2 C T 5: 98,108,496 (GRCm39) W338* probably null Het
Apc2 T C 10: 80,140,801 (GRCm39) S219P probably damaging Het
Arfgap3 A T 15: 83,192,389 (GRCm39) probably null Het
Arrdc5 A G 17: 56,607,020 (GRCm39) V75A possibly damaging Het
Atg16l2 A T 7: 100,949,317 (GRCm39) probably null Het
Cacna1i A G 15: 80,265,281 (GRCm39) N1511S possibly damaging Het
Cad T C 5: 31,235,032 (GRCm39) Y2095H probably damaging Het
Chia1 T C 3: 106,035,753 (GRCm39) probably benign Het
Crybg2 A G 4: 133,801,765 (GRCm39) D975G probably damaging Het
Dagla T C 19: 10,232,247 (GRCm39) I480V probably damaging Het
Efl1 C T 7: 82,301,095 (GRCm39) T33I probably damaging Het
Esp36 A G 17: 38,728,060 (GRCm39) F74L probably benign Het
Faim T C 9: 98,874,149 (GRCm39) probably benign Het
Fam83h G T 15: 75,875,776 (GRCm39) H520Q probably benign Het
Fbn2 A T 18: 58,178,446 (GRCm39) C1931S probably damaging Het
Frs3 A G 17: 48,012,581 (GRCm39) D96G probably benign Het
Gbp4 A G 5: 105,269,706 (GRCm39) M374T probably damaging Het
Gimap1 C T 6: 48,718,359 (GRCm39) probably benign Het
Gm10010 A G 6: 128,177,576 (GRCm39) noncoding transcript Het
Gm10355 T C 3: 101,214,214 (GRCm39) noncoding transcript Het
Gmip C T 8: 70,264,095 (GRCm39) probably benign Het
Gpc2 A T 5: 138,276,796 (GRCm39) F110Y possibly damaging Het
Ifi44l C T 3: 151,468,396 (GRCm39) V45M probably benign Het
Il15 T C 8: 83,069,890 (GRCm39) E58G probably damaging Het
Kat2b T C 17: 53,951,771 (GRCm39) probably benign Het
Kcnh7 C A 2: 62,607,854 (GRCm39) V576L probably benign Het
Lrrc66 T A 5: 73,772,816 (GRCm39) probably benign Het
Mical1 A G 10: 41,358,235 (GRCm39) E416G probably benign Het
Mroh3 A G 1: 136,118,740 (GRCm39) Y526H probably damaging Het
Mtx2 T C 2: 74,699,634 (GRCm39) probably benign Het
Naip6 A T 13: 100,437,036 (GRCm39) Y496N probably benign Het
Nfyc A G 4: 120,626,081 (GRCm39) S73P probably benign Het
Or10v9 C T 19: 11,832,487 (GRCm39) V277M probably damaging Het
Or10v9 A C 19: 11,832,732 (GRCm39) V195G probably damaging Het
Or1e23 T A 11: 73,407,750 (GRCm39) I92F probably damaging Het
Or5ak25 A G 2: 85,268,845 (GRCm39) I219T probably benign Het
Or6c69b T A 10: 129,627,101 (GRCm39) D119V probably damaging Het
P2ry14 A G 3: 59,022,869 (GRCm39) V206A probably benign Het
Polg G A 7: 79,109,896 (GRCm39) probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Ptgs1 G A 2: 36,130,868 (GRCm39) probably benign Het
Pus7l A G 15: 94,421,298 (GRCm39) S671P probably benign Het
Ralgapa2 T C 2: 146,184,112 (GRCm39) T1547A probably benign Het
Rif1 T C 2: 52,001,600 (GRCm39) S1685P probably benign Het
Rnf213 T C 11: 119,361,036 (GRCm39) Y4452H probably damaging Het
Samd7 A G 3: 30,810,670 (GRCm39) D229G probably benign Het
Serpina3j T C 12: 104,281,078 (GRCm39) S84P possibly damaging Het
Slc35d1 A G 4: 103,070,441 (GRCm39) probably benign Het
Sorbs2 A G 8: 46,249,347 (GRCm39) D847G probably damaging Het
Sp110 A C 1: 85,505,050 (GRCm39) F434C probably benign Het
Steap4 T C 5: 8,027,030 (GRCm39) probably benign Het
Tg A C 15: 66,589,057 (GRCm39) T13P probably damaging Het
Timeless T A 10: 128,080,542 (GRCm39) Y474* probably null Het
Trdmt1 G A 2: 13,521,459 (GRCm39) probably benign Het
Trim23 T C 13: 104,337,817 (GRCm39) Y522H probably benign Het
Ttc13 A T 8: 125,401,105 (GRCm39) S624T probably damaging Het
Txnl1 A G 18: 63,825,135 (GRCm39) probably benign Het
Unkl T C 17: 25,427,057 (GRCm39) probably benign Het
Usp54 T A 14: 20,639,437 (GRCm39) probably benign Het
Vcam1 T C 3: 115,910,908 (GRCm39) K497E possibly damaging Het
Vmn1r49 C A 6: 90,049,648 (GRCm39) S118I possibly damaging Het
Vmn2r118 T C 17: 55,915,466 (GRCm39) K495E probably benign Het
Wrnip1 G A 13: 33,005,073 (GRCm39) C560Y possibly damaging Het
Xkr5 T C 8: 18,983,563 (GRCm39) R660G probably benign Het
Zfp280c A G X: 47,637,580 (GRCm39) probably benign Het
Zfp707 G A 15: 75,846,978 (GRCm39) A291T possibly damaging Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115,686,154 (GRCm39) missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115,681,110 (GRCm39) missense probably benign 0.25
IGL01314:Tmem94 APN 11 115,680,835 (GRCm39) missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115,678,364 (GRCm39) missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115,685,571 (GRCm39) missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115,685,571 (GRCm39) missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115,688,258 (GRCm39) missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115,683,897 (GRCm39) missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115,687,227 (GRCm39) nonsense probably null
IGL02816:Tmem94 APN 11 115,679,530 (GRCm39) splice site probably null
IGL02836:Tmem94 APN 11 115,683,765 (GRCm39) missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115,683,247 (GRCm39) missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115,683,224 (GRCm39) missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115,682,894 (GRCm39) unclassified probably benign
IGL03397:Tmem94 APN 11 115,678,394 (GRCm39) unclassified probably benign
capitulate UTSW 11 115,687,572 (GRCm39) missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115,687,550 (GRCm39) unclassified probably benign
R0336:Tmem94 UTSW 11 115,678,211 (GRCm39) missense probably benign
R0370:Tmem94 UTSW 11 115,679,543 (GRCm39) missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115,685,607 (GRCm39) splice site probably null
R0647:Tmem94 UTSW 11 115,687,621 (GRCm39) missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115,682,804 (GRCm39) missense probably benign 0.00
R1469:Tmem94 UTSW 11 115,685,917 (GRCm39) unclassified probably benign
R1616:Tmem94 UTSW 11 115,686,971 (GRCm39) critical splice donor site probably null
R1621:Tmem94 UTSW 11 115,676,671 (GRCm39) missense probably benign
R1682:Tmem94 UTSW 11 115,681,056 (GRCm39) missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115,685,574 (GRCm39) missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115,687,580 (GRCm39) missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115,684,039 (GRCm39) nonsense probably null
R1926:Tmem94 UTSW 11 115,683,726 (GRCm39) missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115,679,500 (GRCm39) missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115,685,154 (GRCm39) missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115,685,575 (GRCm39) missense probably benign
R2419:Tmem94 UTSW 11 115,687,641 (GRCm39) missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115,682,787 (GRCm39) missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115,680,080 (GRCm39) missense probably benign 0.00
R4708:Tmem94 UTSW 11 115,677,121 (GRCm39) missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115,686,938 (GRCm39) nonsense probably null
R5026:Tmem94 UTSW 11 115,683,930 (GRCm39) missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115,684,016 (GRCm39) missense probably benign 0.04
R5716:Tmem94 UTSW 11 115,683,254 (GRCm39) missense probably benign 0.17
R6180:Tmem94 UTSW 11 115,681,857 (GRCm39) critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115,687,572 (GRCm39) missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115,689,112 (GRCm39) missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115,682,814 (GRCm39) missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115,687,287 (GRCm39) missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115,676,656 (GRCm39) missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115,683,764 (GRCm39) missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115,681,781 (GRCm39) splice site probably null
R7181:Tmem94 UTSW 11 115,685,600 (GRCm39) missense probably damaging 0.97
R7290:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7292:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7345:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115,685,000 (GRCm39) missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115,686,971 (GRCm39) critical splice donor site probably null
R7460:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7463:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115,679,204 (GRCm39) missense probably benign 0.05
R7995:Tmem94 UTSW 11 115,688,797 (GRCm39) missense probably damaging 1.00
R8094:Tmem94 UTSW 11 115,679,218 (GRCm39) critical splice donor site probably null
R8447:Tmem94 UTSW 11 115,688,696 (GRCm39) missense probably benign
R8447:Tmem94 UTSW 11 115,688,023 (GRCm39) missense possibly damaging 0.93
R8825:Tmem94 UTSW 11 115,688,201 (GRCm39) missense probably benign 0.00
R8910:Tmem94 UTSW 11 115,688,252 (GRCm39) missense probably damaging 1.00
R9226:Tmem94 UTSW 11 115,683,191 (GRCm39) missense probably damaging 1.00
RF003:Tmem94 UTSW 11 115,686,958 (GRCm39) missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115,677,079 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ACGTGCTGCTGAACCTGTGTAAC -3'
(R):5'- GCCCCTGGAGTGAAACCTATGAAC -3'

Sequencing Primer
(F):5'- TGTAACGCCAGTGTCACTGAG -3'
(R):5'- ACAGAATCTAGCTCGCTTGG -3'
Posted On 2013-07-11