Incidental Mutation 'R7323:Myh2'
ID568298
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7323 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67197365 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1936 (T1936S)
Ref Sequence ENSEMBL: ENSMUSP00000018641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000018641] [ENSMUST00000075734] [ENSMUST00000124516] [ENSMUST00000129018] [ENSMUST00000170159]
Predicted Effect probably benign
Transcript: ENSMUST00000018637
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018641
AA Change: T1936S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: T1936S

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075734
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124516
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129018
SMART Domains Protein: ENSMUSP00000115583
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170159
AA Change: T1936S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: T1936S

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
6030452D12Rik A T 8: 106,500,779 probably null Het
Abcb11 C A 2: 69,287,635 Q466H probably damaging Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm11639 T C 11: 105,030,011 L4676P probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr1509 A G 14: 52,451,213 I267V probably benign Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc27a2 T G 2: 126,553,204 L17R probably benign Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Themis A T 10: 28,733,501 H88L probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Tnfrsf11a A G 1: 105,844,730 D581G probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r69 A C 7: 85,411,764 I204R possibly damaging Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTTCTGCCAGTCTACAGAGC -3'
(R):5'- GTTGACACTGCTTTAGGAAGGG -3'

Sequencing Primer
(F):5'- TCTGCCAGTCTACAGAGCTTAGAAAG -3'
(R):5'- CTGCTTTAGGAAGGGGACAAAAGAC -3'
Posted On2019-06-26